Incidental Mutation 'R4446:Lrat'
ID329884
Institutional Source Beutler Lab
Gene Symbol Lrat
Ensembl Gene ENSMUSG00000028003
Gene Namelecithin-retinol acyltransferase (phosphatidylcholine-retinol-O-acyltransferase)
Synonyms
MMRRC Submission 041707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4446 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location82892579-82903973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82896986 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 228 (M228T)
Ref Sequence ENSEMBL: ENSMUSP00000029632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029632]
PDB Structure
Crystal structure of HRASLS3/LRAT chimeric protein [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000029632
AA Change: M228T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029632
Gene: ENSMUSG00000028003
AA Change: M228T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:LRAT 43 174 1.4e-44 PFAM
low complexity region 194 205 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156457
Meta Mutation Damage Score 0.2536 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 91% (43/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the endoplasmic reticulum, where it catalyzes the esterification of all-trans-retinol into all-trans-retinyl ester. This reaction is an important step in vitamin A metabolism in the visual system. Mutations in this gene have been associated with early-onset severe retinal dystrophy and Leber congenital amaurosis 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit retinol homeostasis abnormalities and are more susceptible to vitamin A deficiency or display impaired vision associated with abnormal retinol metabolism. Males have testicular hypoplasia/atrophy and reduced mature sperm counts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik T A 1: 192,833,423 noncoding transcript Het
Adgrg6 A G 10: 14,409,763 S1160P probably damaging Het
Akt1 C T 12: 112,659,133 R144H probably benign Het
Arrdc3 T C 13: 80,889,063 probably benign Het
Asxl2 T A 12: 3,501,774 V1172E possibly damaging Het
Atp9a C T 2: 168,681,997 A242T possibly damaging Het
C2cd3 C T 7: 100,374,477 T90I probably damaging Het
C4bp A G 1: 130,642,955 S295P probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cep131 T C 11: 120,064,819 E1025G probably damaging Het
Crot T C 5: 8,973,643 H415R probably damaging Het
Cyp17a1 A G 19: 46,668,023 F411L probably damaging Het
Dgkb G T 12: 38,184,953 G439V probably damaging Het
Dgkh A G 14: 78,628,083 V20A probably damaging Het
Dysf A G 6: 84,205,872 N2035S probably damaging Het
Fam69a T C 5: 107,924,634 Y52C probably damaging Het
Fzd1 A G 5: 4,755,777 Y602H probably damaging Het
Gm3139 T A 5: 94,537,843 I454K probably damaging Het
Gm38706 C A 6: 130,483,310 noncoding transcript Het
Hmmr T C 11: 40,715,321 Q274R probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Igsf9b A G 9: 27,334,252 T1172A probably benign Het
Klf5 C T 14: 99,302,230 R360C probably damaging Het
Mms19 A T 19: 41,963,933 M119K possibly damaging Het
Myo3a A T 2: 22,600,137 K565N probably damaging Het
Olfr1378 C T 11: 50,969,863 P282S probably damaging Het
Olfr148 A T 9: 39,613,998 I144L probably benign Het
Olfr411 T C 11: 74,346,762 D274G probably benign Het
Pcdha6 A G 18: 36,967,760 D2G probably benign Het
Pcdhga3 A G 18: 37,675,885 R464G probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Sema6d A G 2: 124,664,059 M596V probably damaging Het
Slc25a25 T C 2: 32,430,609 K47E probably benign Het
Sptbn1 C T 11: 30,139,114 R716H possibly damaging Het
Ssx2ip G A 3: 146,426,431 V216I probably benign Het
Tatdn2 T G 6: 113,702,540 probably null Het
Tmprss6 A G 15: 78,452,839 Y356H probably damaging Het
Ttn A G 2: 76,856,866 probably benign Het
Umod A G 7: 119,466,056 probably null Het
Vmn2r93 T A 17: 18,304,050 I102K possibly damaging Het
Zdhhc6 T C 19: 55,302,737 I349V probably benign Het
Other mutations in Lrat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03206:Lrat APN 3 82903349 missense probably damaging 0.99
R1445:Lrat UTSW 3 82903369 missense probably damaging 1.00
R1491:Lrat UTSW 3 82903342 missense probably benign 0.07
R1735:Lrat UTSW 3 82897110 missense probably benign 0.01
R2419:Lrat UTSW 3 82903685 missense probably damaging 1.00
R5442:Lrat UTSW 3 82903220 missense probably damaging 1.00
R5495:Lrat UTSW 3 82896982 missense probably benign 0.00
R6255:Lrat UTSW 3 82903505 missense probably damaging 1.00
R6468:Lrat UTSW 3 82903492 missense probably damaging 1.00
R6909:Lrat UTSW 3 82903654 missense probably damaging 1.00
R7041:Lrat UTSW 3 82903448 missense probably benign 0.03
R7396:Lrat UTSW 3 82903283 nonsense probably null
Z1177:Lrat UTSW 3 82903490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGCACGTGGTATGATTC -3'
(R):5'- ATCGGGAAGACTACTTGGTCTG -3'

Sequencing Primer
(F):5'- GCAAGCACGTGGTATGATTCTTAATC -3'
(R):5'- TAGCCATGGTTCCTAACAGTC -3'
Posted On2015-07-21