Incidental Mutation 'R4446:Ssx2ip'
ID329885
Institutional Source Beutler Lab
Gene Symbol Ssx2ip
Ensembl Gene ENSMUSG00000036825
Gene Namesynovial sarcoma, X 2 interacting protein
SynonymsAdip
MMRRC Submission 041707-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4446 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146404642-146440144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 146426431 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 216 (V216I)
Ref Sequence ENSEMBL: ENSMUSP00000101759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039021] [ENSMUST00000106149] [ENSMUST00000106151] [ENSMUST00000106153]
Predicted Effect probably benign
Transcript: ENSMUST00000039021
AA Change: V216I

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045663
Gene: ENSMUSG00000036825
AA Change: V216I

DomainStartEndE-ValueType
Pfam:ADIP 63 214 8.5e-51 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 411 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Blast:LPD_N 439 480 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106149
AA Change: V216I

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101755
Gene: ENSMUSG00000036825
AA Change: V216I

DomainStartEndE-ValueType
Pfam:ADIP 63 214 8.5e-51 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 411 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Blast:LPD_N 439 480 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106151
AA Change: V216I

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101757
Gene: ENSMUSG00000036825
AA Change: V216I

DomainStartEndE-ValueType
Pfam:ADIP 63 214 8.5e-51 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 411 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Blast:LPD_N 439 480 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106153
AA Change: V216I

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101759
Gene: ENSMUSG00000036825
AA Change: V216I

DomainStartEndE-ValueType
Pfam:ADIP 63 214 1.2e-47 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 410 N/A INTRINSIC
low complexity region 426 436 N/A INTRINSIC
Blast:LPD_N 440 481 3e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141103
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 91% (43/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the cancer-testis antigen Synovial Sarcoma X breakpoint 2 protein. The encoded protein may regulate the activity of Synovial Sarcoma X breakpoint 2 protein in malignant cells. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik T A 1: 192,833,423 noncoding transcript Het
Adgrg6 A G 10: 14,409,763 S1160P probably damaging Het
Akt1 C T 12: 112,659,133 R144H probably benign Het
Arrdc3 T C 13: 80,889,063 probably benign Het
Asxl2 T A 12: 3,501,774 V1172E possibly damaging Het
Atp9a C T 2: 168,681,997 A242T possibly damaging Het
C2cd3 C T 7: 100,374,477 T90I probably damaging Het
C4bp A G 1: 130,642,955 S295P probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cep131 T C 11: 120,064,819 E1025G probably damaging Het
Crot T C 5: 8,973,643 H415R probably damaging Het
Cyp17a1 A G 19: 46,668,023 F411L probably damaging Het
Dgkb G T 12: 38,184,953 G439V probably damaging Het
Dgkh A G 14: 78,628,083 V20A probably damaging Het
Dysf A G 6: 84,205,872 N2035S probably damaging Het
Fam69a T C 5: 107,924,634 Y52C probably damaging Het
Fzd1 A G 5: 4,755,777 Y602H probably damaging Het
Gm3139 T A 5: 94,537,843 I454K probably damaging Het
Gm38706 C A 6: 130,483,310 noncoding transcript Het
Hmmr T C 11: 40,715,321 Q274R probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Igsf9b A G 9: 27,334,252 T1172A probably benign Het
Klf5 C T 14: 99,302,230 R360C probably damaging Het
Lrat A G 3: 82,896,986 M228T probably damaging Het
Mms19 A T 19: 41,963,933 M119K possibly damaging Het
Myo3a A T 2: 22,600,137 K565N probably damaging Het
Olfr1378 C T 11: 50,969,863 P282S probably damaging Het
Olfr148 A T 9: 39,613,998 I144L probably benign Het
Olfr411 T C 11: 74,346,762 D274G probably benign Het
Pcdha6 A G 18: 36,967,760 D2G probably benign Het
Pcdhga3 A G 18: 37,675,885 R464G probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Sema6d A G 2: 124,664,059 M596V probably damaging Het
Slc25a25 T C 2: 32,430,609 K47E probably benign Het
Sptbn1 C T 11: 30,139,114 R716H possibly damaging Het
Tatdn2 T G 6: 113,702,540 probably null Het
Tmprss6 A G 15: 78,452,839 Y356H probably damaging Het
Ttn A G 2: 76,856,866 probably benign Het
Umod A G 7: 119,466,056 probably null Het
Vmn2r93 T A 17: 18,304,050 I102K possibly damaging Het
Zdhhc6 T C 19: 55,302,737 I349V probably benign Het
Other mutations in Ssx2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Ssx2ip APN 3 146436552 missense probably damaging 1.00
IGL01140:Ssx2ip APN 3 146427843 missense probably benign 0.02
IGL01810:Ssx2ip APN 3 146428010 missense probably benign 0.00
BB004:Ssx2ip UTSW 3 146432610 missense probably damaging 1.00
BB014:Ssx2ip UTSW 3 146432610 missense probably damaging 1.00
R0432:Ssx2ip UTSW 3 146426429 missense probably damaging 1.00
R0903:Ssx2ip UTSW 3 146430977 missense probably benign
R2228:Ssx2ip UTSW 3 146417776 missense probably damaging 0.98
R3151:Ssx2ip UTSW 3 146418383 missense probably benign 0.00
R4348:Ssx2ip UTSW 3 146432490 missense probably benign 0.01
R4796:Ssx2ip UTSW 3 146418359 missense probably benign 0.02
R5054:Ssx2ip UTSW 3 146430917 splice site probably benign
R5338:Ssx2ip UTSW 3 146436541 critical splice acceptor site probably null
R5520:Ssx2ip UTSW 3 146437311 missense probably benign 0.03
R5898:Ssx2ip UTSW 3 146427831 missense possibly damaging 0.94
R6367:Ssx2ip UTSW 3 146419166 missense probably benign 0.16
R6777:Ssx2ip UTSW 3 146438721 missense possibly damaging 0.88
R7082:Ssx2ip UTSW 3 146430948 missense probably benign 0.01
R7239:Ssx2ip UTSW 3 146428016 missense probably damaging 1.00
R7249:Ssx2ip UTSW 3 146426438 missense possibly damaging 0.81
R7772:Ssx2ip UTSW 3 146433130 missense probably damaging 0.99
R7927:Ssx2ip UTSW 3 146432610 missense probably damaging 1.00
R7935:Ssx2ip UTSW 3 146419173 missense probably benign 0.00
R8011:Ssx2ip UTSW 3 146422911 missense probably damaging 0.97
RF004:Ssx2ip UTSW 3 146426440 nonsense probably null
Z1177:Ssx2ip UTSW 3 146428147 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCATCATGTGGGAGCATGG -3'
(R):5'- GCTGACCAAAAGGACTCAATG -3'

Sequencing Primer
(F):5'- GGGACTAGGGCTTGTTTAACC -3'
(R):5'- GCTGACCAAAAGGACTCAATGTTTTG -3'
Posted On2015-07-21