Incidental Mutation 'R4446:Umod'
ID329895
Institutional Source Beutler Lab
Gene Symbol Umod
Ensembl Gene ENSMUSG00000030963
Gene Nameuromodulin
Synonymsuromucoid, urehr4, Urehd1, Tamm-Horsfall glycoprotein
MMRRC Submission 041707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4446 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119462711-119479282 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 119466056 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033263] [ENSMUST00000209095]
Predicted Effect probably null
Transcript: ENSMUST00000033263
SMART Domains Protein: ENSMUSP00000033263
Gene: ENSMUSG00000030963

DomainStartEndE-ValueType
EGF 31 64 4.03e-1 SMART
EGF_CA 65 106 3.81e-11 SMART
EGF_CA 107 155 4.81e-8 SMART
Blast:ZP 256 325 6e-30 BLAST
ZP 335 586 2.19e-70 SMART
low complexity region 619 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208401
Predicted Effect probably null
Transcript: ENSMUST00000209095
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 91% (43/47)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein that is the most abundant protein in mammalian urine under physiological conditions. It is synthesized in the kidney as a glycosyl-phosphatidylinositol anchored protein and released into urine as a soluble form by proteolytic cleavage. It is thought to regulate water and salt balance in the thick ascending limb of Henle and to protect against urinary tract infection and calcium oxalate crystal formation. In mouse deficiency of this gene is associated with increased susceptibility to bacterial infections and formation of calcium crystals in kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene causes renal dysfunction and increased susceptibility to bladder infection, and may lead to renal calcinosis and stone formation. Homozygotes for an ENU-induced allele exhibit renal dysfunction and alterations in ureahandling, energy, bone, and lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik T A 1: 192,833,423 noncoding transcript Het
Adgrg6 A G 10: 14,409,763 S1160P probably damaging Het
Akt1 C T 12: 112,659,133 R144H probably benign Het
Arrdc3 T C 13: 80,889,063 probably benign Het
Asxl2 T A 12: 3,501,774 V1172E possibly damaging Het
Atp9a C T 2: 168,681,997 A242T possibly damaging Het
C2cd3 C T 7: 100,374,477 T90I probably damaging Het
C4bp A G 1: 130,642,955 S295P probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cep131 T C 11: 120,064,819 E1025G probably damaging Het
Crot T C 5: 8,973,643 H415R probably damaging Het
Cyp17a1 A G 19: 46,668,023 F411L probably damaging Het
Dgkb G T 12: 38,184,953 G439V probably damaging Het
Dgkh A G 14: 78,628,083 V20A probably damaging Het
Dysf A G 6: 84,205,872 N2035S probably damaging Het
Fam69a T C 5: 107,924,634 Y52C probably damaging Het
Fzd1 A G 5: 4,755,777 Y602H probably damaging Het
Gm3139 T A 5: 94,537,843 I454K probably damaging Het
Gm38706 C A 6: 130,483,310 noncoding transcript Het
Hmmr T C 11: 40,715,321 Q274R probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Igsf9b A G 9: 27,334,252 T1172A probably benign Het
Klf5 C T 14: 99,302,230 R360C probably damaging Het
Lrat A G 3: 82,896,986 M228T probably damaging Het
Mms19 A T 19: 41,963,933 M119K possibly damaging Het
Myo3a A T 2: 22,600,137 K565N probably damaging Het
Olfr1378 C T 11: 50,969,863 P282S probably damaging Het
Olfr148 A T 9: 39,613,998 I144L probably benign Het
Olfr411 T C 11: 74,346,762 D274G probably benign Het
Pcdha6 A G 18: 36,967,760 D2G probably benign Het
Pcdhga3 A G 18: 37,675,885 R464G probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Sema6d A G 2: 124,664,059 M596V probably damaging Het
Slc25a25 T C 2: 32,430,609 K47E probably benign Het
Sptbn1 C T 11: 30,139,114 R716H possibly damaging Het
Ssx2ip G A 3: 146,426,431 V216I probably benign Het
Tatdn2 T G 6: 113,702,540 probably null Het
Tmprss6 A G 15: 78,452,839 Y356H probably damaging Het
Ttn A G 2: 76,856,866 probably benign Het
Vmn2r93 T A 17: 18,304,050 I102K possibly damaging Het
Zdhhc6 T C 19: 55,302,737 I349V probably benign Het
Other mutations in Umod
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Umod APN 7 119477219 missense possibly damaging 0.93
IGL02527:Umod APN 7 119469467 missense probably damaging 1.00
R0265:Umod UTSW 7 119466073 missense probably benign 0.00
R1073:Umod UTSW 7 119464741 missense possibly damaging 0.56
R1117:Umod UTSW 7 119477306 missense possibly damaging 0.71
R1515:Umod UTSW 7 119465497 missense probably benign 0.00
R1774:Umod UTSW 7 119477351 missense possibly damaging 0.82
R1803:Umod UTSW 7 119464724 missense probably damaging 0.96
R1864:Umod UTSW 7 119463255 missense probably damaging 0.99
R1942:Umod UTSW 7 119476932 missense probably damaging 1.00
R2060:Umod UTSW 7 119476715 missense probably damaging 0.97
R2354:Umod UTSW 7 119466193 missense probably damaging 1.00
R3015:Umod UTSW 7 119472540 missense probably damaging 1.00
R3030:Umod UTSW 7 119476839 missense probably benign 0.02
R4016:Umod UTSW 7 119476690 missense possibly damaging 0.56
R4406:Umod UTSW 7 119466064 missense probably damaging 1.00
R5062:Umod UTSW 7 119472421 nonsense probably null
R5358:Umod UTSW 7 119472354 missense probably damaging 1.00
R5935:Umod UTSW 7 119471427 missense probably damaging 1.00
R6045:Umod UTSW 7 119476823 missense probably benign
R6239:Umod UTSW 7 119477297 missense probably damaging 1.00
R7111:Umod UTSW 7 119477146 nonsense probably null
R7168:Umod UTSW 7 119478326 splice site probably benign
R7265:Umod UTSW 7 119466073 missense probably benign 0.00
R7273:Umod UTSW 7 119477027 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCAGCTTGCAAATAAGGTCAG -3'
(R):5'- AGTTGTCCACGTACAGAAGATAC -3'

Sequencing Primer
(F):5'- GGTCAGTTTATCAGCCAAGAACCTTG -3'
(R):5'- GTACAGAAGATACAACCATTCAGG -3'
Posted On2015-07-21