Incidental Mutation 'R4446:Hmmr'
ID329902
Institutional Source Beutler Lab
Gene Symbol Hmmr
Ensembl Gene ENSMUSG00000020330
Gene Namehyaluronan mediated motility receptor (RHAMM)
SynonymsCD168, Rhamm
MMRRC Submission 041707-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4446 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location40701395-40733422 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40715321 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 274 (Q274R)
Ref Sequence ENSEMBL: ENSMUSP00000020579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020579]
Predicted Effect probably damaging
Transcript: ENSMUST00000020579
AA Change: Q274R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020579
Gene: ENSMUSG00000020330
AA Change: Q274R

DomainStartEndE-ValueType
Pfam:HMMR_N 15 339 1.2e-136 PFAM
low complexity region 375 385 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
Blast:MA 452 578 7e-6 BLAST
Pfam:HMMR_C 636 789 4.3e-71 PFAM
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 91% (43/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in cell motility. It is expressed in breast tissue and together with other proteins, it forms a complex with BRCA1 and BRCA2, thus is potentially associated with higher risk of breast cancer. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit impaired fertility and are less susceptible to the formation of aggressive fibromatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik T A 1: 192,833,423 noncoding transcript Het
Adgrg6 A G 10: 14,409,763 S1160P probably damaging Het
Akt1 C T 12: 112,659,133 R144H probably benign Het
Arrdc3 T C 13: 80,889,063 probably benign Het
Asxl2 T A 12: 3,501,774 V1172E possibly damaging Het
Atp9a C T 2: 168,681,997 A242T possibly damaging Het
C2cd3 C T 7: 100,374,477 T90I probably damaging Het
C4bp A G 1: 130,642,955 S295P probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cep131 T C 11: 120,064,819 E1025G probably damaging Het
Crot T C 5: 8,973,643 H415R probably damaging Het
Cyp17a1 A G 19: 46,668,023 F411L probably damaging Het
Dgkb G T 12: 38,184,953 G439V probably damaging Het
Dgkh A G 14: 78,628,083 V20A probably damaging Het
Dysf A G 6: 84,205,872 N2035S probably damaging Het
Fam69a T C 5: 107,924,634 Y52C probably damaging Het
Fzd1 A G 5: 4,755,777 Y602H probably damaging Het
Gm3139 T A 5: 94,537,843 I454K probably damaging Het
Gm38706 C A 6: 130,483,310 noncoding transcript Het
Homer3 G A 8: 70,290,143 probably null Het
Igsf9b A G 9: 27,334,252 T1172A probably benign Het
Klf5 C T 14: 99,302,230 R360C probably damaging Het
Lrat A G 3: 82,896,986 M228T probably damaging Het
Mms19 A T 19: 41,963,933 M119K possibly damaging Het
Myo3a A T 2: 22,600,137 K565N probably damaging Het
Olfr1378 C T 11: 50,969,863 P282S probably damaging Het
Olfr148 A T 9: 39,613,998 I144L probably benign Het
Olfr411 T C 11: 74,346,762 D274G probably benign Het
Pcdha6 A G 18: 36,967,760 D2G probably benign Het
Pcdhga3 A G 18: 37,675,885 R464G probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Sema6d A G 2: 124,664,059 M596V probably damaging Het
Slc25a25 T C 2: 32,430,609 K47E probably benign Het
Sptbn1 C T 11: 30,139,114 R716H possibly damaging Het
Ssx2ip G A 3: 146,426,431 V216I probably benign Het
Tatdn2 T G 6: 113,702,540 probably null Het
Tmprss6 A G 15: 78,452,839 Y356H probably damaging Het
Ttn A G 2: 76,856,866 probably benign Het
Umod A G 7: 119,466,056 probably null Het
Vmn2r93 T A 17: 18,304,050 I102K possibly damaging Het
Zdhhc6 T C 19: 55,302,737 I349V probably benign Het
Other mutations in Hmmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01795:Hmmr APN 11 40721734 missense probably benign 0.25
IGL02096:Hmmr APN 11 40707429 missense probably benign 0.02
IGL02224:Hmmr APN 11 40710004 missense unknown
IGL02527:Hmmr APN 11 40708105 missense probably damaging 1.00
IGL02870:Hmmr APN 11 40714075 missense possibly damaging 0.63
IGL03175:Hmmr APN 11 40714809 missense probably benign 0.02
IGL03327:Hmmr APN 11 40715415 missense probably damaging 1.00
R0126:Hmmr UTSW 11 40705954 missense probably damaging 1.00
R0211:Hmmr UTSW 11 40714808 missense probably damaging 0.96
R0533:Hmmr UTSW 11 40709989 missense unknown
R0610:Hmmr UTSW 11 40715902 missense probably damaging 1.00
R0747:Hmmr UTSW 11 40721745 splice site probably benign
R1909:Hmmr UTSW 11 40708098 missense probably damaging 1.00
R2013:Hmmr UTSW 11 40728432 missense possibly damaging 0.85
R4897:Hmmr UTSW 11 40728434 missense probably benign 0.00
R4937:Hmmr UTSW 11 40721840 missense possibly damaging 0.90
R5795:Hmmr UTSW 11 40721906 missense probably damaging 1.00
R5873:Hmmr UTSW 11 40707700 missense probably damaging 0.99
R6414:Hmmr UTSW 11 40715867 critical splice donor site probably null
R6962:Hmmr UTSW 11 40707415 missense probably damaging 1.00
R7391:Hmmr UTSW 11 40707786 intron probably null
R7558:Hmmr UTSW 11 40733329 missense probably damaging 1.00
T0975:Hmmr UTSW 11 40723416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAAAGAGTGCAATATGTCAAAA -3'
(R):5'- TTTTGCACAGAGAAAACAAAAGCAC -3'

Sequencing Primer
(F):5'- TCTCAAGTACAGCACATGAATTTTC -3'
(R):5'- AAAGCACCTTATTTTGTTGAACATG -3'
Posted On2015-07-21