Incidental Mutation 'R4446:Dgkb'
ID329908
Institutional Source Beutler Lab
Gene Symbol Dgkb
Ensembl Gene ENSMUSG00000036095
Gene Namediacylglycerol kinase, beta
SynonymsC630029D13Rik, DGK-beta
MMRRC Submission 041707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R4446 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location37817726-38634239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 38184953 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 439 (G439V)
Ref Sequence ENSEMBL: ENSMUSP00000152378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040500] [ENSMUST00000220990]
Predicted Effect probably damaging
Transcript: ENSMUST00000040500
AA Change: G439V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037900
Gene: ENSMUSG00000036095
AA Change: G439V

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 6 141 1.4e-49 PFAM
EFh 145 173 1.82e-4 SMART
EFh 190 218 1.18e-3 SMART
C1 235 286 7.11e-16 SMART
C1 302 350 9.25e-6 SMART
DAGKc 429 553 2.58e-68 SMART
DAGKa 573 753 8.02e-106 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220990
AA Change: G439V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221540
Meta Mutation Damage Score 0.8904 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 91% (43/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Diacylglycerol kinases (DGKs) are regulators of the intracellular concentration of the second messenger diacylglycerol (DAG) and thus play a key role in cellular processes. Nine mammalian isotypes have been identified, which are encoded by separate genes. Mammalian DGK isozymes contain a conserved catalytic (kinase) domain and a cysteine-rich domain (CRD). The protein encoded by this gene is a diacylglycerol kinase, beta isotype. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transposon distruption have defects in long term potentiation, synapase morphology, and in spatial reference and working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik T A 1: 192,833,423 noncoding transcript Het
Adgrg6 A G 10: 14,409,763 S1160P probably damaging Het
Akt1 C T 12: 112,659,133 R144H probably benign Het
Arrdc3 T C 13: 80,889,063 probably benign Het
Asxl2 T A 12: 3,501,774 V1172E possibly damaging Het
Atp9a C T 2: 168,681,997 A242T possibly damaging Het
C2cd3 C T 7: 100,374,477 T90I probably damaging Het
C4bp A G 1: 130,642,955 S295P probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cep131 T C 11: 120,064,819 E1025G probably damaging Het
Crot T C 5: 8,973,643 H415R probably damaging Het
Cyp17a1 A G 19: 46,668,023 F411L probably damaging Het
Dgkh A G 14: 78,628,083 V20A probably damaging Het
Dysf A G 6: 84,205,872 N2035S probably damaging Het
Fam69a T C 5: 107,924,634 Y52C probably damaging Het
Fzd1 A G 5: 4,755,777 Y602H probably damaging Het
Gm3139 T A 5: 94,537,843 I454K probably damaging Het
Gm38706 C A 6: 130,483,310 noncoding transcript Het
Hmmr T C 11: 40,715,321 Q274R probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Igsf9b A G 9: 27,334,252 T1172A probably benign Het
Klf5 C T 14: 99,302,230 R360C probably damaging Het
Lrat A G 3: 82,896,986 M228T probably damaging Het
Mms19 A T 19: 41,963,933 M119K possibly damaging Het
Myo3a A T 2: 22,600,137 K565N probably damaging Het
Olfr1378 C T 11: 50,969,863 P282S probably damaging Het
Olfr148 A T 9: 39,613,998 I144L probably benign Het
Olfr411 T C 11: 74,346,762 D274G probably benign Het
Pcdha6 A G 18: 36,967,760 D2G probably benign Het
Pcdhga3 A G 18: 37,675,885 R464G probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Sema6d A G 2: 124,664,059 M596V probably damaging Het
Slc25a25 T C 2: 32,430,609 K47E probably benign Het
Sptbn1 C T 11: 30,139,114 R716H possibly damaging Het
Ssx2ip G A 3: 146,426,431 V216I probably benign Het
Tatdn2 T G 6: 113,702,540 probably null Het
Tmprss6 A G 15: 78,452,839 Y356H probably damaging Het
Ttn A G 2: 76,856,866 probably benign Het
Umod A G 7: 119,466,056 probably null Het
Vmn2r93 T A 17: 18,304,050 I102K possibly damaging Het
Zdhhc6 T C 19: 55,302,737 I349V probably benign Het
Other mutations in Dgkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Dgkb APN 12 38438568 missense probably benign 0.05
IGL00768:Dgkb APN 12 38427479 missense probably benign 0.00
IGL00792:Dgkb APN 12 38214389 critical splice donor site probably null
IGL00934:Dgkb APN 12 38427456 missense probably damaging 0.98
IGL00970:Dgkb APN 12 38190083 missense probably damaging 1.00
IGL01152:Dgkb APN 12 38084234 missense probably damaging 1.00
IGL01489:Dgkb APN 12 38127385 critical splice donor site probably null
IGL01993:Dgkb APN 12 37982010 missense probably benign 0.19
IGL02212:Dgkb APN 12 38139414 missense probably damaging 1.00
IGL02687:Dgkb APN 12 38630629 missense possibly damaging 0.94
IGL02986:Dgkb APN 12 38100400 missense possibly damaging 0.88
IGL03155:Dgkb APN 12 38139459 missense probably damaging 1.00
IGL03174:Dgkb APN 12 38216054 missense possibly damaging 0.93
IGL03198:Dgkb APN 12 38136616 missense probably damaging 0.97
R0063:Dgkb UTSW 12 38604113 missense probably benign
R0063:Dgkb UTSW 12 38604113 missense probably benign
R0078:Dgkb UTSW 12 38136541 missense probably benign 0.35
R0271:Dgkb UTSW 12 38228026 missense probably damaging 1.00
R0359:Dgkb UTSW 12 38216031 missense probably benign 0.17
R0396:Dgkb UTSW 12 38190135 critical splice donor site probably null
R0547:Dgkb UTSW 12 38604158 missense probably benign 0.39
R0554:Dgkb UTSW 12 38216031 missense probably benign 0.17
R1903:Dgkb UTSW 12 38166777 critical splice donor site probably null
R2004:Dgkb UTSW 12 38084229 missense probably damaging 1.00
R2265:Dgkb UTSW 12 38190108 missense possibly damaging 0.61
R2941:Dgkb UTSW 12 38604123 missense possibly damaging 0.96
R3177:Dgkb UTSW 12 38084217 missense probably damaging 0.98
R3277:Dgkb UTSW 12 38084217 missense probably damaging 0.98
R4319:Dgkb UTSW 12 38438599 missense probably damaging 1.00
R4578:Dgkb UTSW 12 38427493 missense possibly damaging 0.87
R4601:Dgkb UTSW 12 38602820 missense probably damaging 0.96
R4799:Dgkb UTSW 12 38114568 missense possibly damaging 0.89
R4937:Dgkb UTSW 12 38114658 nonsense probably null
R5380:Dgkb UTSW 12 38127300 missense possibly damaging 0.89
R5485:Dgkb UTSW 12 38127364 missense probably damaging 1.00
R5556:Dgkb UTSW 12 38127364 missense probably damaging 1.00
R6198:Dgkb UTSW 12 38173823 missense probably benign
R6467:Dgkb UTSW 12 38084224 missense possibly damaging 0.65
R6467:Dgkb UTSW 12 38604105 missense probably damaging 1.00
R6792:Dgkb UTSW 12 38100425 missense possibly damaging 0.48
R7056:Dgkb UTSW 12 38100493 missense probably benign
R7116:Dgkb UTSW 12 37981990 missense probably benign 0.00
R7251:Dgkb UTSW 12 37981986 missense possibly damaging 0.77
R7265:Dgkb UTSW 12 38184932 missense possibly damaging 0.91
R7268:Dgkb UTSW 12 38147555 nonsense probably null
R7342:Dgkb UTSW 12 38100433 missense probably benign 0.00
R7535:Dgkb UTSW 12 38136647 missense probably damaging 1.00
R7540:Dgkb UTSW 12 37981790 start gained probably benign
R7584:Dgkb UTSW 12 38139392 splice site probably null
R7714:Dgkb UTSW 12 38630593 missense probably damaging 0.99
R7885:Dgkb UTSW 12 38139426 missense probably damaging 1.00
R8012:Dgkb UTSW 12 38139486 missense probably benign 0.31
R8050:Dgkb UTSW 12 38124217 missense probably benign 0.38
R8089:Dgkb UTSW 12 38184950 missense probably damaging 1.00
R8103:Dgkb UTSW 12 38136581 missense probably damaging 1.00
R8400:Dgkb UTSW 12 38602838 critical splice donor site probably null
R8418:Dgkb UTSW 12 38330017 missense probably damaging 1.00
X0023:Dgkb UTSW 12 38227989 missense probably benign 0.00
X0027:Dgkb UTSW 12 38228125 critical splice donor site probably null
Z1176:Dgkb UTSW 12 37981996 missense possibly damaging 0.77
Z1176:Dgkb UTSW 12 38136613 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTCCTGGTGGCCACAGATAC -3'
(R):5'- TCATGCTCTGGTTAAAGGTTAACTG -3'

Sequencing Primer
(F):5'- CTGGTGGCCACAGATACACTTTAATG -3'
(R):5'- GCTCTGGTTAAAGGTTAACTGTTATG -3'
Posted On2015-07-21