Incidental Mutation 'R4446:Cyp17a1'
ID 329918
Institutional Source Beutler Lab
Gene Symbol Cyp17a1
Ensembl Gene ENSMUSG00000003555
Gene Name cytochrome P450, family 17, subfamily a, polypeptide 1
Synonyms p450c17, Cyp17, steroid 17-alpha hydroxylase
MMRRC Submission 041707-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R4446 (G1)
Quality Score 205
Status Validated
Chromosome 19
Chromosomal Location 46655604-46661439 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46656462 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 411 (F411L)
Ref Sequence ENSEMBL: ENSMUSP00000026012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026012]
AlphaFold P27786
Predicted Effect probably damaging
Transcript: ENSMUST00000026012
AA Change: F411L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: F411L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:p450 28 492 2.6e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156577
Meta Mutation Damage Score 0.9476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 91% (43/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik T A 1: 192,515,731 (GRCm39) noncoding transcript Het
Adgrg6 A G 10: 14,285,507 (GRCm39) S1160P probably damaging Het
Akt1 C T 12: 112,625,567 (GRCm39) R144H probably benign Het
Arrdc3 T C 13: 81,037,182 (GRCm39) probably benign Het
Asxl2 T A 12: 3,551,774 (GRCm39) V1172E possibly damaging Het
Atp9a C T 2: 168,523,917 (GRCm39) A242T possibly damaging Het
C2cd3 C T 7: 100,023,684 (GRCm39) T90I probably damaging Het
C4bp A G 1: 130,570,692 (GRCm39) S295P probably benign Het
Cdkl2 G A 5: 92,168,168 (GRCm39) T342I probably benign Het
Cep131 T C 11: 119,955,645 (GRCm39) E1025G probably damaging Het
Crot T C 5: 9,023,643 (GRCm39) H415R probably damaging Het
Dgkb G T 12: 38,234,952 (GRCm39) G439V probably damaging Het
Dgkh A G 14: 78,865,523 (GRCm39) V20A probably damaging Het
Dipk1a T C 5: 108,072,500 (GRCm39) Y52C probably damaging Het
Dysf A G 6: 84,182,854 (GRCm39) N2035S probably damaging Het
Fzd1 A G 5: 4,805,777 (GRCm39) Y602H probably damaging Het
Gm38706 C A 6: 130,460,273 (GRCm39) noncoding transcript Het
Hmmr T C 11: 40,606,148 (GRCm39) Q274R probably damaging Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Igsf9b A G 9: 27,245,548 (GRCm39) T1172A probably benign Het
Klf5 C T 14: 99,539,666 (GRCm39) R360C probably damaging Het
Lrat A G 3: 82,804,293 (GRCm39) M228T probably damaging Het
Mms19 A T 19: 41,952,372 (GRCm39) M119K possibly damaging Het
Myo3a A T 2: 22,490,149 (GRCm39) K565N probably damaging Het
Or10n1 A T 9: 39,525,294 (GRCm39) I144L probably benign Het
Or1ad6 C T 11: 50,860,690 (GRCm39) P282S probably damaging Het
Or3a1d T C 11: 74,237,588 (GRCm39) D274G probably benign Het
Pcdha6 A G 18: 37,100,813 (GRCm39) D2G probably benign Het
Pcdhga3 A G 18: 37,808,938 (GRCm39) R464G probably damaging Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Pramel42 T A 5: 94,685,702 (GRCm39) I454K probably damaging Het
Rnf13 A C 3: 57,728,010 (GRCm39) K230T probably damaging Het
Sema6d A G 2: 124,505,979 (GRCm39) M596V probably damaging Het
Slc25a25 T C 2: 32,320,621 (GRCm39) K47E probably benign Het
Sptbn1 C T 11: 30,089,114 (GRCm39) R716H possibly damaging Het
Ssx2ip G A 3: 146,132,186 (GRCm39) V216I probably benign Het
Tatdn2 T G 6: 113,679,501 (GRCm39) probably null Het
Tmprss6 A G 15: 78,337,039 (GRCm39) Y356H probably damaging Het
Ttn A G 2: 76,687,210 (GRCm39) probably benign Het
Umod A G 7: 119,065,279 (GRCm39) probably null Het
Vmn2r93 T A 17: 18,524,312 (GRCm39) I102K possibly damaging Het
Zdhhc6 T C 19: 55,291,169 (GRCm39) I349V probably benign Het
Other mutations in Cyp17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Cyp17a1 APN 19 46,659,495 (GRCm39) missense probably benign 0.00
IGL01839:Cyp17a1 APN 19 46,659,110 (GRCm39) missense possibly damaging 0.89
IGL01901:Cyp17a1 APN 19 46,659,531 (GRCm39) missense possibly damaging 0.64
IGL02033:Cyp17a1 APN 19 46,661,046 (GRCm39) nonsense probably null
IGL02349:Cyp17a1 APN 19 46,655,936 (GRCm39) missense probably damaging 1.00
IGL02663:Cyp17a1 APN 19 46,661,005 (GRCm39) missense probably damaging 1.00
IGL02883:Cyp17a1 APN 19 46,657,790 (GRCm39) missense probably benign 0.00
IGL03092:Cyp17a1 APN 19 46,661,050 (GRCm39) missense possibly damaging 0.79
IGL03239:Cyp17a1 APN 19 46,655,796 (GRCm39) missense probably damaging 1.00
IGL03336:Cyp17a1 APN 19 46,659,474 (GRCm39) missense probably benign 0.00
R3773:Cyp17a1 UTSW 19 46,658,162 (GRCm39) missense probably damaging 0.97
R4445:Cyp17a1 UTSW 19 46,656,462 (GRCm39) missense probably damaging 1.00
R4572:Cyp17a1 UTSW 19 46,658,990 (GRCm39) missense probably damaging 1.00
R5544:Cyp17a1 UTSW 19 46,661,093 (GRCm39) missense probably damaging 1.00
R5730:Cyp17a1 UTSW 19 46,661,095 (GRCm39) missense possibly damaging 0.49
R6163:Cyp17a1 UTSW 19 46,657,761 (GRCm39) missense possibly damaging 0.69
R6271:Cyp17a1 UTSW 19 46,661,159 (GRCm39) missense probably benign 0.17
R6728:Cyp17a1 UTSW 19 46,657,673 (GRCm39) missense probably benign
R6729:Cyp17a1 UTSW 19 46,659,020 (GRCm39) missense probably benign
R7025:Cyp17a1 UTSW 19 46,659,419 (GRCm39) missense probably damaging 0.98
R7395:Cyp17a1 UTSW 19 46,659,134 (GRCm39) missense probably benign
R8056:Cyp17a1 UTSW 19 46,659,030 (GRCm39) missense possibly damaging 0.95
R8308:Cyp17a1 UTSW 19 46,656,516 (GRCm39) missense probably benign 0.09
R8735:Cyp17a1 UTSW 19 46,659,533 (GRCm39) critical splice acceptor site probably null
R8737:Cyp17a1 UTSW 19 46,658,166 (GRCm39) missense probably benign 0.09
R9091:Cyp17a1 UTSW 19 46,656,030 (GRCm39) missense probably benign 0.00
R9270:Cyp17a1 UTSW 19 46,656,030 (GRCm39) missense probably benign 0.00
R9364:Cyp17a1 UTSW 19 46,657,165 (GRCm39) missense probably damaging 1.00
R9554:Cyp17a1 UTSW 19 46,657,165 (GRCm39) missense probably damaging 1.00
X0020:Cyp17a1 UTSW 19 46,659,459 (GRCm39) missense possibly damaging 0.88
Z1177:Cyp17a1 UTSW 19 46,661,098 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTGGGGCAATCTCCAGTAG -3'
(R):5'- TCTAGATGTAATCCTGGCAGAAACC -3'

Sequencing Primer
(F):5'- CAATCTCCAGTAGGATGGGAAC -3'
(R):5'- ATGATTGAGAATGGGGGAGGGTTC -3'
Posted On 2015-07-21