Incidental Mutation 'R4446:Cyp17a1'
ID329918
Institutional Source Beutler Lab
Gene Symbol Cyp17a1
Ensembl Gene ENSMUSG00000003555
Gene Namecytochrome P450, family 17, subfamily a, polypeptide 1
Synonymssteroid 17-alpha hydroxylase, p450c17, Cyp17
MMRRC Submission 041707-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.412) question?
Stock #R4446 (G1)
Quality Score205
Status Validated
Chromosome19
Chromosomal Location46667165-46672974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46668023 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 411 (F411L)
Ref Sequence ENSEMBL: ENSMUSP00000026012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026012]
Predicted Effect probably damaging
Transcript: ENSMUST00000026012
AA Change: F411L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: F411L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:p450 28 492 2.6e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156577
Meta Mutation Damage Score 0.9476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 91% (43/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik T A 1: 192,833,423 noncoding transcript Het
Adgrg6 A G 10: 14,409,763 S1160P probably damaging Het
Akt1 C T 12: 112,659,133 R144H probably benign Het
Arrdc3 T C 13: 80,889,063 probably benign Het
Asxl2 T A 12: 3,501,774 V1172E possibly damaging Het
Atp9a C T 2: 168,681,997 A242T possibly damaging Het
C2cd3 C T 7: 100,374,477 T90I probably damaging Het
C4bp A G 1: 130,642,955 S295P probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cep131 T C 11: 120,064,819 E1025G probably damaging Het
Crot T C 5: 8,973,643 H415R probably damaging Het
Dgkb G T 12: 38,184,953 G439V probably damaging Het
Dgkh A G 14: 78,628,083 V20A probably damaging Het
Dysf A G 6: 84,205,872 N2035S probably damaging Het
Fam69a T C 5: 107,924,634 Y52C probably damaging Het
Fzd1 A G 5: 4,755,777 Y602H probably damaging Het
Gm3139 T A 5: 94,537,843 I454K probably damaging Het
Gm38706 C A 6: 130,483,310 noncoding transcript Het
Hmmr T C 11: 40,715,321 Q274R probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Igsf9b A G 9: 27,334,252 T1172A probably benign Het
Klf5 C T 14: 99,302,230 R360C probably damaging Het
Lrat A G 3: 82,896,986 M228T probably damaging Het
Mms19 A T 19: 41,963,933 M119K possibly damaging Het
Myo3a A T 2: 22,600,137 K565N probably damaging Het
Olfr1378 C T 11: 50,969,863 P282S probably damaging Het
Olfr148 A T 9: 39,613,998 I144L probably benign Het
Olfr411 T C 11: 74,346,762 D274G probably benign Het
Pcdha6 A G 18: 36,967,760 D2G probably benign Het
Pcdhga3 A G 18: 37,675,885 R464G probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Sema6d A G 2: 124,664,059 M596V probably damaging Het
Slc25a25 T C 2: 32,430,609 K47E probably benign Het
Sptbn1 C T 11: 30,139,114 R716H possibly damaging Het
Ssx2ip G A 3: 146,426,431 V216I probably benign Het
Tatdn2 T G 6: 113,702,540 probably null Het
Tmprss6 A G 15: 78,452,839 Y356H probably damaging Het
Ttn A G 2: 76,856,866 probably benign Het
Umod A G 7: 119,466,056 probably null Het
Vmn2r93 T A 17: 18,304,050 I102K possibly damaging Het
Zdhhc6 T C 19: 55,302,737 I349V probably benign Het
Other mutations in Cyp17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Cyp17a1 APN 19 46671056 missense probably benign 0.00
IGL01839:Cyp17a1 APN 19 46670671 missense possibly damaging 0.89
IGL01901:Cyp17a1 APN 19 46671092 missense possibly damaging 0.64
IGL02033:Cyp17a1 APN 19 46672607 nonsense probably null
IGL02349:Cyp17a1 APN 19 46667497 missense probably damaging 1.00
IGL02663:Cyp17a1 APN 19 46672566 missense probably damaging 1.00
IGL02883:Cyp17a1 APN 19 46669351 missense probably benign 0.00
IGL03092:Cyp17a1 APN 19 46672611 missense possibly damaging 0.79
IGL03239:Cyp17a1 APN 19 46667357 missense probably damaging 1.00
IGL03336:Cyp17a1 APN 19 46671035 missense probably benign 0.00
R3773:Cyp17a1 UTSW 19 46669723 missense probably damaging 0.97
R4445:Cyp17a1 UTSW 19 46668023 missense probably damaging 1.00
R4572:Cyp17a1 UTSW 19 46670551 missense probably damaging 1.00
R5544:Cyp17a1 UTSW 19 46672654 missense probably damaging 1.00
R5730:Cyp17a1 UTSW 19 46672656 missense possibly damaging 0.49
R6163:Cyp17a1 UTSW 19 46669322 missense possibly damaging 0.69
R6271:Cyp17a1 UTSW 19 46672720 missense probably benign 0.17
R6728:Cyp17a1 UTSW 19 46669234 missense probably benign
R6729:Cyp17a1 UTSW 19 46670581 missense probably benign
R7025:Cyp17a1 UTSW 19 46670980 missense probably damaging 0.98
R7395:Cyp17a1 UTSW 19 46670695 missense probably benign
R8056:Cyp17a1 UTSW 19 46670591 missense possibly damaging 0.95
R8308:Cyp17a1 UTSW 19 46668077 missense probably benign 0.09
X0020:Cyp17a1 UTSW 19 46671020 missense possibly damaging 0.88
Z1177:Cyp17a1 UTSW 19 46672659 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTGGGGCAATCTCCAGTAG -3'
(R):5'- TCTAGATGTAATCCTGGCAGAAACC -3'

Sequencing Primer
(F):5'- CAATCTCCAGTAGGATGGGAAC -3'
(R):5'- ATGATTGAGAATGGGGGAGGGTTC -3'
Posted On2015-07-21