Incidental Mutation 'R4457:Dnah7c'
ID 329921
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Name dynein, axonemal, heavy chain 7C
Synonyms Dnahc7c
MMRRC Submission 041717-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.340) question?
Stock # R4457 (G1)
Quality Score 207
Status Not validated
Chromosome 1
Chromosomal Location 46464752-46846636 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46779781 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 3161 (N3161S)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000189749
AA Change: N3161S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: N3161S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (62/64)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A G 16: 90,351,260 (GRCm39) noncoding transcript Het
1700025G04Rik T C 1: 151,796,805 (GRCm39) R87G probably damaging Het
9030619P08Rik T A 15: 75,303,249 (GRCm39) noncoding transcript Het
Akap13 A G 7: 75,389,213 (GRCm39) D2377G probably damaging Het
Arhgef5 T C 6: 43,251,027 (GRCm39) S593P probably damaging Het
Atp4a G A 7: 30,419,650 (GRCm39) R671Q probably benign Het
Cdkn2d C G 9: 21,202,185 (GRCm39) V21L probably benign Het
Cfap73 T C 5: 120,768,215 (GRCm39) K181R possibly damaging Het
Chn1 A G 2: 73,443,427 (GRCm39) I383T probably damaging Het
Cmtr2 A G 8: 110,948,884 (GRCm39) D398G probably benign Het
Dnah12 T C 14: 26,537,464 (GRCm39) Y2238H probably damaging Het
Dnah8 C A 17: 31,032,125 (GRCm39) H4148Q probably benign Het
Ehbp1l1 T C 19: 5,766,321 (GRCm39) S397G possibly damaging Het
Eya4 A T 10: 22,992,566 (GRCm39) S462R probably damaging Het
Fam227b T A 2: 125,988,188 (GRCm39) probably benign Het
Frrs1 G A 3: 116,690,377 (GRCm39) V7I probably benign Het
Fsip2 G T 2: 82,821,120 (GRCm39) A5618S possibly damaging Het
Gja10 A T 4: 32,601,073 (GRCm39) M437K probably benign Het
Gm2840 T G 5: 96,322,187 (GRCm39) noncoding transcript Het
Gm4956 A G 1: 21,368,319 (GRCm39) noncoding transcript Het
Gria4 A G 9: 4,427,074 (GRCm39) W789R probably damaging Het
Hoxb5 A G 11: 96,194,546 (GRCm39) D36G probably damaging Het
Hps5 A T 7: 46,433,037 (GRCm39) C228S probably benign Het
Hspa4 A T 11: 53,171,395 (GRCm39) C270S probably damaging Het
Htra4 C A 8: 25,528,674 (GRCm39) A73S possibly damaging Het
Ikzf2 T C 1: 69,723,347 (GRCm39) probably benign Het
Ivl G A 3: 92,479,673 (GRCm39) H131Y probably benign Het
Kat6a A G 8: 23,422,129 (GRCm39) probably null Het
Lamp3 T A 16: 19,492,279 (GRCm39) M322L probably benign Het
Letmd1 T C 15: 100,373,011 (GRCm39) V37A possibly damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Myh1 G A 11: 67,111,441 (GRCm39) G1627R probably benign Het
Myo9b A G 8: 71,743,643 (GRCm39) I235V probably damaging Het
Ndor1 A G 2: 25,138,128 (GRCm39) probably null Het
Ndufa12 A T 10: 94,056,680 (GRCm39) K136M probably damaging Het
Or2t49 A G 11: 58,392,944 (GRCm39) L146P probably damaging Het
Or4a78 A T 2: 89,497,427 (GRCm39) S268T probably benign Het
Or51g2 C T 7: 102,622,734 (GRCm39) S155N probably damaging Het
Or5d44 A G 2: 88,141,173 (GRCm39) probably benign Het
Pcdha2 A G 18: 37,073,599 (GRCm39) D410G probably damaging Het
Pcyox1l T A 18: 61,830,939 (GRCm39) N311I probably benign Het
Pif1 A G 9: 65,495,058 (GRCm39) probably benign Het
Pkp1 CTCTTCTT CTCTT 1: 135,803,362 (GRCm39) probably null Het
Pogz G A 3: 94,763,374 (GRCm39) V49I probably benign Het
Rab36 G A 10: 74,880,328 (GRCm39) V63I probably damaging Het
Rnf4 A G 5: 34,508,705 (GRCm39) Y189C probably benign Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Sgms2 A C 3: 131,118,665 (GRCm39) Y273D probably damaging Het
Slc25a10 G A 11: 120,387,915 (GRCm39) V203I probably benign Het
Slc4a2 T A 5: 24,639,328 (GRCm39) probably benign Het
Tbc1d13 A G 2: 30,025,450 (GRCm39) probably benign Het
Tdrd7 A G 4: 46,007,526 (GRCm39) N526S probably benign Het
Tet2 C T 3: 133,191,324 (GRCm39) D1037N possibly damaging Het
Thrb T A 14: 18,011,187 (GRCm38) W188R probably damaging Het
Ttn T C 2: 76,777,257 (GRCm39) M1382V probably benign Het
Usp9y T A Y: 1,394,078 (GRCm39) I551L possibly damaging Het
Vwde T C 6: 13,196,100 (GRCm39) I308M probably damaging Het
Zan T C 5: 137,409,778 (GRCm39) I3488V unknown Het
Zgrf1 A T 3: 127,389,578 (GRCm39) I375F probably damaging Het
Zic4 A G 9: 91,261,315 (GRCm39) K183R probably damaging Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46,846,449 (GRCm39) missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46,696,271 (GRCm39) missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46,563,277 (GRCm39) missense probably benign 0.37
IGL03161:Dnah7c APN 1 46,506,456 (GRCm39) missense probably benign 0.20
IGL03178:Dnah7c APN 1 46,506,525 (GRCm39) missense probably benign
IGL03052:Dnah7c UTSW 1 46,671,309 (GRCm39) missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46,505,065 (GRCm39) missense probably benign
R1029:Dnah7c UTSW 1 46,651,881 (GRCm39) missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46,837,439 (GRCm39) missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46,668,071 (GRCm39) missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46,720,977 (GRCm39) missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46,705,150 (GRCm39) missense probably benign 0.01
R4303:Dnah7c UTSW 1 46,787,738 (GRCm39) missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46,688,441 (GRCm39) missense probably benign 0.33
R4434:Dnah7c UTSW 1 46,705,442 (GRCm39) missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46,787,795 (GRCm39) missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46,805,771 (GRCm39) missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46,572,091 (GRCm39) missense probably benign 0.34
R4571:Dnah7c UTSW 1 46,572,376 (GRCm39) missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46,553,743 (GRCm39) nonsense probably null
R4731:Dnah7c UTSW 1 46,809,333 (GRCm39) missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46,809,333 (GRCm39) missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46,809,333 (GRCm39) missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46,572,328 (GRCm39) missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46,832,692 (GRCm39) missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46,728,085 (GRCm39) missense probably benign
R4875:Dnah7c UTSW 1 46,728,085 (GRCm39) missense probably benign
R4916:Dnah7c UTSW 1 46,634,168 (GRCm39) missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46,569,660 (GRCm39) missense probably benign
R5279:Dnah7c UTSW 1 46,558,429 (GRCm39) missense probably benign 0.14
R5327:Dnah7c UTSW 1 46,704,728 (GRCm39) missense probably benign 0.05
R5546:Dnah7c UTSW 1 46,705,477 (GRCm39) missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46,837,395 (GRCm39) missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46,799,521 (GRCm39) splice site probably null
R5639:Dnah7c UTSW 1 46,778,828 (GRCm39) missense probably benign
R5663:Dnah7c UTSW 1 46,574,308 (GRCm39) missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46,787,826 (GRCm39) missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46,654,527 (GRCm39) missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46,678,825 (GRCm39) missense probably benign 0.00
R5784:Dnah7c UTSW 1 46,563,228 (GRCm39) missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46,686,175 (GRCm39) missense probably benign 0.01
R5933:Dnah7c UTSW 1 46,558,375 (GRCm39) missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46,711,657 (GRCm39) missense probably benign 0.21
R6034:Dnah7c UTSW 1 46,496,418 (GRCm39) missense probably benign 0.00
R6034:Dnah7c UTSW 1 46,496,418 (GRCm39) missense probably benign 0.00
R6487:Dnah7c UTSW 1 46,808,284 (GRCm39) missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46,697,450 (GRCm39) missense probably benign 0.00
R6614:Dnah7c UTSW 1 46,688,511 (GRCm39) missense probably benign
R6614:Dnah7c UTSW 1 46,688,500 (GRCm39) missense probably benign
R6615:Dnah7c UTSW 1 46,688,511 (GRCm39) missense probably benign
R6615:Dnah7c UTSW 1 46,554,599 (GRCm39) missense probably benign 0.01
R6615:Dnah7c UTSW 1 46,688,500 (GRCm39) missense probably benign
R6649:Dnah7c UTSW 1 46,688,511 (GRCm39) missense probably benign
R6649:Dnah7c UTSW 1 46,688,500 (GRCm39) missense probably benign
R6650:Dnah7c UTSW 1 46,688,511 (GRCm39) missense probably benign
R6650:Dnah7c UTSW 1 46,688,500 (GRCm39) missense probably benign
R6651:Dnah7c UTSW 1 46,688,511 (GRCm39) missense probably benign
R6651:Dnah7c UTSW 1 46,688,500 (GRCm39) missense probably benign
R6653:Dnah7c UTSW 1 46,688,511 (GRCm39) missense probably benign
R6653:Dnah7c UTSW 1 46,688,500 (GRCm39) missense probably benign
R6714:Dnah7c UTSW 1 46,779,966 (GRCm39) missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46,711,681 (GRCm39) missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46,688,511 (GRCm39) missense probably benign
R6760:Dnah7c UTSW 1 46,688,500 (GRCm39) missense probably benign
R6763:Dnah7c UTSW 1 46,668,050 (GRCm39) missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46,696,403 (GRCm39) missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46,566,831 (GRCm39) missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46,705,373 (GRCm39) missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46,494,973 (GRCm39) missense probably benign 0.07
R7007:Dnah7c UTSW 1 46,571,910 (GRCm39) missense probably benign 0.04
R7086:Dnah7c UTSW 1 46,789,285 (GRCm39) missense probably benign 0.00
R7128:Dnah7c UTSW 1 46,566,645 (GRCm39) missense probably benign
R7131:Dnah7c UTSW 1 46,720,932 (GRCm39) missense probably benign 0.00
R7135:Dnah7c UTSW 1 46,572,368 (GRCm39) missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46,719,898 (GRCm39) missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46,469,969 (GRCm39) missense probably benign 0.00
R7221:Dnah7c UTSW 1 46,494,937 (GRCm39) missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46,636,127 (GRCm39) missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46,819,935 (GRCm39) missense probably benign 0.31
R7319:Dnah7c UTSW 1 46,823,608 (GRCm39) missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46,705,223 (GRCm39) missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46,686,196 (GRCm39) missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46,496,450 (GRCm39) missense probably benign
R7534:Dnah7c UTSW 1 46,809,227 (GRCm39) missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46,823,658 (GRCm39) missense probably benign 0.00
R7605:Dnah7c UTSW 1 46,671,470 (GRCm39) missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46,641,973 (GRCm39) missense probably benign
R7770:Dnah7c UTSW 1 46,665,460 (GRCm39) splice site probably null
R7884:Dnah7c UTSW 1 46,830,929 (GRCm39) missense probably benign 0.23
R7899:Dnah7c UTSW 1 46,553,861 (GRCm39) missense probably benign 0.00
R8025:Dnah7c UTSW 1 46,496,456 (GRCm39) missense probably benign 0.01
R8057:Dnah7c UTSW 1 46,728,112 (GRCm39) missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46,646,618 (GRCm39) missense possibly damaging 0.56
R8255:Dnah7c UTSW 1 46,698,589 (GRCm39) missense probably damaging 1.00
R8428:Dnah7c UTSW 1 46,711,536 (GRCm39) missense probably damaging 1.00
R8441:Dnah7c UTSW 1 46,572,398 (GRCm39) missense probably damaging 1.00
R8485:Dnah7c UTSW 1 46,719,952 (GRCm39) missense probably benign 0.05
R8559:Dnah7c UTSW 1 46,764,299 (GRCm39) missense probably damaging 1.00
R8752:Dnah7c UTSW 1 46,711,701 (GRCm39) missense probably benign 0.00
R8869:Dnah7c UTSW 1 46,671,504 (GRCm39) missense probably damaging 0.97
R9058:Dnah7c UTSW 1 46,805,816 (GRCm39) missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46,816,896 (GRCm39) missense probably benign 0.00
R9121:Dnah7c UTSW 1 46,704,650 (GRCm39) missense probably damaging 0.97
R9246:Dnah7c UTSW 1 46,571,934 (GRCm39) missense possibly damaging 0.51
R9319:Dnah7c UTSW 1 46,521,168 (GRCm39) missense possibly damaging 0.94
R9388:Dnah7c UTSW 1 46,779,886 (GRCm39) missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46,654,441 (GRCm39) missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46,506,462 (GRCm39) missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46,799,476 (GRCm39) missense possibly damaging 0.95
Z1176:Dnah7c UTSW 1 46,686,152 (GRCm39) critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46,678,825 (GRCm39) missense probably benign
Z1177:Dnah7c UTSW 1 46,693,263 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGCAGGAAGTCCATGTCTCAG -3'
(R):5'- GGCTCGATGTTGGCTAGATC -3'

Sequencing Primer
(F):5'- ATTTTTCAGATAATTGTCATGGCATG -3'
(R):5'- CTAGATCAGCGATGGAGAAGAAC -3'
Posted On 2015-07-21