Incidental Mutation 'R4457:Tet2'
ID329937
Institutional Source Beutler Lab
Gene Symbol Tet2
Ensembl Gene ENSMUSG00000040943
Gene Nametet methylcytosine dioxygenase 2
SynonymsE130014J05Rik, Ayu17-449
MMRRC Submission 041717-MU
Accession Numbers

Ncbi RefSeq: NM_001040400.2; MGI:2443298

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4457 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location133463679-133545139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 133485563 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1037 (D1037N)
Ref Sequence ENSEMBL: ENSMUSP00000143029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098603] [ENSMUST00000196398] [ENSMUST00000197118]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098603
AA Change: D1037N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096203
Gene: ENSMUSG00000040943
AA Change: D1037N

DomainStartEndE-ValueType
low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1203 1819 7e-301 SMART
low complexity region 1832 1844 N/A INTRINSIC
low complexity region 1885 1897 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196398
AA Change: D1037N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143029
Gene: ENSMUSG00000040943
AA Change: D1037N

DomainStartEndE-ValueType
low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1211 1827 3.4e-305 SMART
low complexity region 1840 1852 N/A INTRINSIC
low complexity region 1893 1905 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200203
Meta Mutation Damage Score 0.0643 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (62/64)
MGI Phenotype Strain: 5285413; 4345275; 3813933; 5301343
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele die shortly after birth and exhibit a loss of acidic granules in the proximal convoluted tubules of the kidneys. Mice homozygous for a conditional allele activated in hematopoeitic compartment exhibit self-renewal and myeloid transforamtion. [provided by MGI curators]
Allele List at MGI

All alleles(1246) : Targeted(6) Gene trapped(1240)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A G 16: 90,554,372 noncoding transcript Het
1700025G04Rik T C 1: 151,921,054 R87G probably damaging Het
9030619P08Rik T A 15: 75,431,400 noncoding transcript Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Arhgef5 T C 6: 43,274,093 S593P probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cfap73 T C 5: 120,630,150 K181R possibly damaging Het
Chn1 A G 2: 73,613,083 I383T probably damaging Het
Cmtr2 A G 8: 110,222,252 D398G probably benign Het
Dnah12 T C 14: 26,815,507 Y2238H probably damaging Het
Dnah7c A G 1: 46,740,621 N3161S probably damaging Het
Dnah8 C A 17: 30,813,151 H4148Q probably benign Het
Ehbp1l1 T C 19: 5,716,293 S397G possibly damaging Het
Eya4 A T 10: 23,116,668 S462R probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Frrs1 G A 3: 116,896,728 V7I probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gja10 A T 4: 32,601,073 M437K probably benign Het
Gm2840 T G 5: 96,174,328 noncoding transcript Het
Gm4956 A G 1: 21,298,095 noncoding transcript Het
Gria4 A G 9: 4,427,074 W789R probably damaging Het
Hoxb5 A G 11: 96,303,720 D36G probably damaging Het
Hps5 A T 7: 46,783,613 C228S probably benign Het
Hspa4 A T 11: 53,280,568 C270S probably damaging Het
Htra4 C A 8: 25,038,658 A73S possibly damaging Het
Ikzf2 T C 1: 69,684,188 probably benign Het
Ivl G A 3: 92,572,366 H131Y probably benign Het
Kat6a A G 8: 22,932,113 probably null Het
Lamp3 T A 16: 19,673,529 M322L probably benign Het
Letmd1 T C 15: 100,475,130 V37A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh1 G A 11: 67,220,615 G1627R probably benign Het
Myo9b A G 8: 71,290,999 I235V probably damaging Het
Ndor1 A G 2: 25,248,116 probably null Het
Ndufa12 A T 10: 94,220,818 K136M probably damaging Het
Olfr1174-ps A G 2: 88,310,829 probably benign Het
Olfr1251 A T 2: 89,667,083 S268T probably benign Het
Olfr331 A G 11: 58,502,118 L146P probably damaging Het
Olfr577 C T 7: 102,973,527 S155N probably damaging Het
Pcdha2 A G 18: 36,940,546 D410G probably damaging Het
Pcyox1l T A 18: 61,697,868 N311I probably benign Het
Pif1 A G 9: 65,587,776 probably benign Het
Pkp1 CTCTTCTT CTCTT 1: 135,875,624 probably null Het
Pogz G A 3: 94,856,063 V49I probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rnf4 A G 5: 34,351,361 Y189C probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sgms2 A C 3: 131,325,016 Y273D probably damaging Het
Slc25a10 G A 11: 120,497,089 V203I probably benign Het
Slc4a2 T A 5: 24,434,330 probably benign Het
Tbc1d13 A G 2: 30,135,438 probably benign Het
Tdrd7 A G 4: 46,007,526 N526S probably benign Het
Thrb T A 14: 18,011,187 W188R probably damaging Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Usp9y T A Y: 1,394,078 I551L possibly damaging Het
Vwde T C 6: 13,196,101 I308M probably damaging Het
Zan T C 5: 137,411,516 I3488V unknown Het
Zgrf1 A T 3: 127,595,929 I375F probably damaging Het
Zic4 A G 9: 91,379,262 K183R probably damaging Het
Other mutations in Tet2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Tet2 APN 3 133488085 missense possibly damaging 0.96
IGL00401:Tet2 APN 3 133466882 missense possibly damaging 0.72
IGL01528:Tet2 APN 3 133480298 missense possibly damaging 0.86
IGL02053:Tet2 APN 3 133488523 missense possibly damaging 0.96
IGL02142:Tet2 APN 3 133480139 missense possibly damaging 0.96
IGL02512:Tet2 APN 3 133469308 missense probably benign 0.05
IGL03148:Tet2 APN 3 133481363 missense probably benign 0.18
IGL03182:Tet2 APN 3 133471398 nonsense probably null
IGL03371:Tet2 APN 3 133467551 missense possibly damaging 0.71
P0022:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0023:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0031:Tet2 UTSW 3 133480202 missense possibly damaging 0.53
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0463:Tet2 UTSW 3 133486666 missense possibly damaging 0.86
R0522:Tet2 UTSW 3 133466804 missense probably damaging 0.98
R0593:Tet2 UTSW 3 133488109 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467602 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467725 missense probably benign 0.01
R0698:Tet2 UTSW 3 133467384 missense probably benign 0.32
R0723:Tet2 UTSW 3 133467284 missense probably benign
R0726:Tet2 UTSW 3 133468184 missense probably benign
R0747:Tet2 UTSW 3 133467470 missense possibly damaging 0.86
R1006:Tet2 UTSW 3 133476601 missense possibly damaging 0.53
R1382:Tet2 UTSW 3 133476615 missense probably damaging 1.00
R1455:Tet2 UTSW 3 133473645 missense possibly damaging 0.51
R1550:Tet2 UTSW 3 133469519 missense probably benign 0.32
R1647:Tet2 UTSW 3 133485880 missense probably benign
R1662:Tet2 UTSW 3 133466852 missense possibly damaging 0.96
R1727:Tet2 UTSW 3 133487290 missense probably damaging 0.98
R1738:Tet2 UTSW 3 133481387 missense probably benign 0.08
R1749:Tet2 UTSW 3 133480131 critical splice donor site probably null
R1869:Tet2 UTSW 3 133481441 splice site probably null
R1887:Tet2 UTSW 3 133487333 missense possibly damaging 0.68
R1937:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1939:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1940:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1997:Tet2 UTSW 3 133486589 nonsense probably null
R2082:Tet2 UTSW 3 133485727 missense possibly damaging 0.96
R2084:Tet2 UTSW 3 133487767 missense possibly damaging 0.68
R2215:Tet2 UTSW 3 133486601 missense probably benign 0.03
R2321:Tet2 UTSW 3 133486339 missense possibly damaging 0.53
R2873:Tet2 UTSW 3 133486954 missense probably damaging 1.00
R3439:Tet2 UTSW 3 133466831 missense possibly damaging 0.93
R3783:Tet2 UTSW 3 133479363 missense possibly damaging 0.53
R3894:Tet2 UTSW 3 133469477 missense possibly damaging 0.86
R3916:Tet2 UTSW 3 133486055 missense possibly damaging 0.53
R3966:Tet2 UTSW 3 133487657 missense possibly damaging 0.73
R4633:Tet2 UTSW 3 133485549 missense probably benign 0.33
R4646:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4647:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4648:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4691:Tet2 UTSW 3 133486083 missense possibly damaging 0.73
R4805:Tet2 UTSW 3 133467315 missense probably benign 0.32
R4829:Tet2 UTSW 3 133476620 missense possibly damaging 0.91
R4901:Tet2 UTSW 3 133467044 missense possibly damaging 0.86
R4975:Tet2 UTSW 3 133486759 unclassified probably benign
R5004:Tet2 UTSW 3 133487379 missense possibly damaging 0.84
R5075:Tet2 UTSW 3 133486906 missense probably benign
R5137:Tet2 UTSW 3 133476565 missense probably benign 0.32
R5324:Tet2 UTSW 3 133485913 missense probably benign 0.00
R5590:Tet2 UTSW 3 133476480 splice site probably null
R5854:Tet2 UTSW 3 133487885 missense probably damaging 0.98
R5856:Tet2 UTSW 3 133486640 missense probably benign 0.01
R5865:Tet2 UTSW 3 133487099 missense probably benign 0.08
R5879:Tet2 UTSW 3 133487960 missense possibly damaging 0.96
R5935:Tet2 UTSW 3 133488535 missense possibly damaging 0.68
R6012:Tet2 UTSW 3 133466781 missense possibly damaging 0.86
R6075:Tet2 UTSW 3 133471435 missense possibly damaging 0.71
R6181:Tet2 UTSW 3 133487759 nonsense probably null
R6188:Tet2 UTSW 3 133480326 missense probably benign 0.18
R6339:Tet2 UTSW 3 133486417 missense possibly damaging 0.53
R6612:Tet2 UTSW 3 133487335 missense possibly damaging 0.53
R6923:Tet2 UTSW 3 133479341 critical splice donor site probably null
R6934:Tet2 UTSW 3 133483237 critical splice donor site probably null
R7076:Tet2 UTSW 3 133467023 missense possibly damaging 0.71
R7155:Tet2 UTSW 3 133469591 missense possibly damaging 0.71
R7184:Tet2 UTSW 3 133473630 missense probably damaging 0.98
R7200:Tet2 UTSW 3 133487192 missense probably benign 0.18
R7459:Tet2 UTSW 3 133480289 missense possibly damaging 0.53
R7504:Tet2 UTSW 3 133487339 missense probably benign 0.33
R7524:Tet2 UTSW 3 133480229 missense probably benign 0.33
R7613:Tet2 UTSW 3 133466748 missense possibly damaging 0.83
R7653:Tet2 UTSW 3 133486385 missense probably benign 0.18
R7691:Tet2 UTSW 3 133486849 missense probably damaging 0.98
R7770:Tet2 UTSW 3 133480295 missense possibly damaging 0.53
R7807:Tet2 UTSW 3 133486541 missense possibly damaging 0.53
R7813:Tet2 UTSW 3 133473643 missense probably benign 0.06
X0021:Tet2 UTSW 3 133486295 missense possibly damaging 0.85
X0066:Tet2 UTSW 3 133488373 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGAATGACTTGATTCCTCAGGGG -3'
(R):5'- TGGAACAGCACCTGAAGCAG -3'

Sequencing Primer
(F):5'- ACTTTTGTAGGGTGATGACTGGAC -3'
(R):5'- GAAGCAGTTTCAGCTCAAGTC -3'
Posted On2015-07-21