Mutagenetix > Incidental Mutations

Incidental Mutation 'R4457:Tet2'

329937

Institutional Source

Beutler Lab

Gene Symbol

Tet2

Ensembl Gene

ENSMUSG00000040943

Gene Name

tet methylcytosine dioxygenase 2

Synonyms

E130014J05Rik, Ayu17-449

MMRRC Submission

041717-MU

Accession Numbers

Ncbi RefSeq: NM_001040400.2; MGI:2443298

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4457 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

133463679-133545139 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 133485563 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 1037 (D1037N)

Ref Sequence

ENSEMBL: ENSMUSP00000143029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098603] [ENSMUST00000196398] [ENSMUST00000197118]

AlphaFold

Q4JK59

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098603
AA Change: D1037N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000096203
Gene: ENSMUSG00000040943
AA Change: D1037N

Domain	Start	End	E-Value	Type
low complexity region	690	701	N/A	INTRINSIC
low complexity region	855	862	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	899	921	N/A	INTRINSIC
Tet_JBP	1203	1819	7e-301	SMART
low complexity region	1832	1844	N/A	INTRINSIC
low complexity region	1885	1897	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000196398
AA Change: D1037N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000143029
Gene: ENSMUSG00000040943
AA Change: D1037N

Domain	Start	End	E-Value	Type
low complexity region	690	701	N/A	INTRINSIC
low complexity region	855	862	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	899	921	N/A	INTRINSIC
Tet_JBP	1211	1827	3.4e-305	SMART
low complexity region	1840	1852	N/A	INTRINSIC
low complexity region	1893	1905	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197118

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200203

Meta Mutation Damage Score

0.0643

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (62/64)

MGI Phenotype

Strain: 5285413; 4345275; 3813933; 5301343
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele die shortly after birth and exhibit a loss of acidic granules in the proximal convoluted tubules of the kidneys. Mice homozygous for a conditional allele activated in hematopoeitic compartment exhibit self-renewal and myeloid transforamtion. [provided by MGI curators]

Allele List at MGI

All alleles(1246) : Targeted(6) Gene trapped(1240)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008E08Rik	A	G	16: 90,554,372		noncoding transcript	Het
1700025G04Rik	T	C	1: 151,921,054	R87G	probably damaging	Het
9030619P08Rik	T	A	15: 75,431,400		noncoding transcript	Het
Akap13	A	G	7: 75,739,465	D2377G	probably damaging	Het
Arhgef5	T	C	6: 43,274,093	S593P	probably damaging	Het
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
Cdkn2d	C	G	9: 21,290,889	V21L	probably benign	Het
Cfap73	T	C	5: 120,630,150	K181R	possibly damaging	Het
Chn1	A	G	2: 73,613,083	I383T	probably damaging	Het
Cmtr2	A	G	8: 110,222,252	D398G	probably benign	Het
Dnah12	T	C	14: 26,815,507	Y2238H	probably damaging	Het
Dnah7c	A	G	1: 46,740,621	N3161S	probably damaging	Het
Dnah8	C	A	17: 30,813,151	H4148Q	probably benign	Het
Ehbp1l1	T	C	19: 5,716,293	S397G	possibly damaging	Het
Eya4	A	T	10: 23,116,668	S462R	probably damaging	Het
Fam227b	T	A	2: 126,146,268		probably benign	Het
Frrs1	G	A	3: 116,896,728	V7I	probably benign	Het
Fsip2	G	T	2: 82,990,776	A5618S	possibly damaging	Het
Gja10	A	T	4: 32,601,073	M437K	probably benign	Het
Gm2840	T	G	5: 96,174,328		noncoding transcript	Het
Gm4956	A	G	1: 21,298,095		noncoding transcript	Het
Gria4	A	G	9: 4,427,074	W789R	probably damaging	Het
Hoxb5	A	G	11: 96,303,720	D36G	probably damaging	Het
Hps5	A	T	7: 46,783,613	C228S	probably benign	Het
Hspa4	A	T	11: 53,280,568	C270S	probably damaging	Het
Htra4	C	A	8: 25,038,658	A73S	possibly damaging	Het
Ikzf2	T	C	1: 69,684,188		probably benign	Het
Ivl	G	A	3: 92,572,366	H131Y	probably benign	Het
Kat6a	A	G	8: 22,932,113		probably null	Het
Lamp3	T	A	16: 19,673,529	M322L	probably benign	Het
Letmd1	T	C	15: 100,475,130	V37A	possibly damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myh1	G	A	11: 67,220,615	G1627R	probably benign	Het
Myo9b	A	G	8: 71,290,999	I235V	probably damaging	Het
Ndor1	A	G	2: 25,248,116		probably null	Het
Ndufa12	A	T	10: 94,220,818	K136M	probably damaging	Het
Olfr1174-ps	A	G	2: 88,310,829		probably benign	Het
Olfr1251	A	T	2: 89,667,083	S268T	probably benign	Het
Olfr331	A	G	11: 58,502,118	L146P	probably damaging	Het
Olfr577	C	T	7: 102,973,527	S155N	probably damaging	Het
Pcdha2	A	G	18: 36,940,546	D410G	probably damaging	Het
Pcyox1l	T	A	18: 61,697,868	N311I	probably benign	Het
Pif1	A	G	9: 65,587,776		probably benign	Het
Pkp1	CTCTTCTT	CTCTT	1: 135,875,624		probably null	Het
Pogz	G	A	3: 94,856,063	V49I	probably benign	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rnf4	A	G	5: 34,351,361	Y189C	probably benign	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Sgms2	A	C	3: 131,325,016	Y273D	probably damaging	Het
Slc25a10	G	A	11: 120,497,089	V203I	probably benign	Het
Slc4a2	T	A	5: 24,434,330		probably benign	Het
Tbc1d13	A	G	2: 30,135,438		probably benign	Het
Tdrd7	A	G	4: 46,007,526	N526S	probably benign	Het
Thrb	T	A	14: 18,011,187	W188R	probably damaging	Het
Ttn	T	C	2: 76,946,913	M1382V	probably benign	Het
Usp9y	T	A	Y: 1,394,078	I551L	possibly damaging	Het
Vwde	T	C	6: 13,196,101	I308M	probably damaging	Het
Zan	T	C	5: 137,411,516	I3488V	unknown	Het
Zgrf1	A	T	3: 127,595,929	I375F	probably damaging	Het
Zic4	A	G	9: 91,379,262	K183R	probably damaging	Het

Other mutations in Tet2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Tet2	APN	3	133488085	missense	possibly damaging	0.96
IGL00401:Tet2	APN	3	133466882	missense	possibly damaging	0.72
IGL01528:Tet2	APN	3	133480298	missense	possibly damaging	0.86
IGL02053:Tet2	APN	3	133488523	missense	possibly damaging	0.96
IGL02142:Tet2	APN	3	133480139	missense	possibly damaging	0.96
IGL02512:Tet2	APN	3	133469308	missense	probably benign	0.05
IGL03148:Tet2	APN	3	133481363	missense	probably benign	0.18
IGL03182:Tet2	APN	3	133471398	nonsense	probably null
IGL03371:Tet2	APN	3	133467551	missense	possibly damaging	0.71
P0022:Tet2	UTSW	3	133486893	missense	probably benign	0.01
P0023:Tet2	UTSW	3	133486893	missense	probably benign	0.01
P0031:Tet2	UTSW	3	133480202	missense	possibly damaging	0.53
R0012:Tet2	UTSW	3	133476558	missense	probably damaging	0.98
R0012:Tet2	UTSW	3	133476558	missense	probably damaging	0.98
R0463:Tet2	UTSW	3	133486666	missense	possibly damaging	0.86
R0522:Tet2	UTSW	3	133466804	missense	probably damaging	0.98
R0593:Tet2	UTSW	3	133488109	missense	probably benign	0.00
R0600:Tet2	UTSW	3	133467602	missense	probably benign	0.00
R0600:Tet2	UTSW	3	133467725	missense	probably benign	0.01
R0698:Tet2	UTSW	3	133467384	missense	probably benign	0.32
R0723:Tet2	UTSW	3	133467284	missense	probably benign
R0726:Tet2	UTSW	3	133468184	missense	probably benign
R0747:Tet2	UTSW	3	133467470	missense	possibly damaging	0.86
R1006:Tet2	UTSW	3	133476601	missense	possibly damaging	0.53
R1382:Tet2	UTSW	3	133476615	missense	probably damaging	1.00
R1455:Tet2	UTSW	3	133473645	missense	possibly damaging	0.51
R1550:Tet2	UTSW	3	133469519	missense	probably benign	0.32
R1647:Tet2	UTSW	3	133485880	missense	probably benign
R1662:Tet2	UTSW	3	133466852	missense	possibly damaging	0.96
R1727:Tet2	UTSW	3	133487290	missense	probably damaging	0.98
R1738:Tet2	UTSW	3	133481387	missense	probably benign	0.08
R1749:Tet2	UTSW	3	133480131	critical splice donor site	probably null
R1869:Tet2	UTSW	3	133481441	splice site	probably null
R1887:Tet2	UTSW	3	133487333	missense	possibly damaging	0.68
R1937:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1939:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1940:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1997:Tet2	UTSW	3	133486589	nonsense	probably null
R2082:Tet2	UTSW	3	133485727	missense	possibly damaging	0.96
R2084:Tet2	UTSW	3	133487767	missense	possibly damaging	0.68
R2215:Tet2	UTSW	3	133486601	missense	probably benign	0.03
R2321:Tet2	UTSW	3	133486339	missense	possibly damaging	0.53
R2873:Tet2	UTSW	3	133486954	missense	probably damaging	1.00
R3439:Tet2	UTSW	3	133466831	missense	possibly damaging	0.93
R3783:Tet2	UTSW	3	133479363	missense	possibly damaging	0.53
R3894:Tet2	UTSW	3	133469477	missense	possibly damaging	0.86
R3916:Tet2	UTSW	3	133486055	missense	possibly damaging	0.53
R3966:Tet2	UTSW	3	133487657	missense	possibly damaging	0.73
R4633:Tet2	UTSW	3	133485549	missense	probably benign	0.33
R4646:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4647:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4648:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4691:Tet2	UTSW	3	133486083	missense	possibly damaging	0.73
R4805:Tet2	UTSW	3	133467315	missense	probably benign	0.32
R4829:Tet2	UTSW	3	133476620	missense	possibly damaging	0.91
R4901:Tet2	UTSW	3	133467044	missense	possibly damaging	0.86
R4975:Tet2	UTSW	3	133486759	unclassified	probably benign
R5004:Tet2	UTSW	3	133487379	missense	possibly damaging	0.84
R5075:Tet2	UTSW	3	133486906	missense	probably benign
R5137:Tet2	UTSW	3	133476565	missense	probably benign	0.32
R5324:Tet2	UTSW	3	133485913	missense	probably benign	0.00
R5590:Tet2	UTSW	3	133476480	splice site	probably null
R5854:Tet2	UTSW	3	133487885	missense	probably damaging	0.98
R5856:Tet2	UTSW	3	133486640	missense	probably benign	0.01
R5865:Tet2	UTSW	3	133487099	missense	probably benign	0.08
R5879:Tet2	UTSW	3	133487960	missense	possibly damaging	0.96
R5935:Tet2	UTSW	3	133488535	missense	possibly damaging	0.68
R6012:Tet2	UTSW	3	133466781	missense	possibly damaging	0.86
R6075:Tet2	UTSW	3	133471435	missense	possibly damaging	0.71
R6181:Tet2	UTSW	3	133487759	nonsense	probably null
R6188:Tet2	UTSW	3	133480326	missense	probably benign	0.18
R6339:Tet2	UTSW	3	133486417	missense	possibly damaging	0.53
R6612:Tet2	UTSW	3	133487335	missense	possibly damaging	0.53
R6923:Tet2	UTSW	3	133479341	critical splice donor site	probably null
R6934:Tet2	UTSW	3	133483237	critical splice donor site	probably null
R7076:Tet2	UTSW	3	133467023	missense	possibly damaging	0.71
R7155:Tet2	UTSW	3	133469591	missense	possibly damaging	0.71
R7184:Tet2	UTSW	3	133473630	missense	probably damaging	0.98
R7200:Tet2	UTSW	3	133487192	missense	probably benign	0.18
R7459:Tet2	UTSW	3	133480289	missense	possibly damaging	0.53
R7504:Tet2	UTSW	3	133487339	missense	probably benign	0.33
R7524:Tet2	UTSW	3	133480229	missense	probably benign	0.33
R7613:Tet2	UTSW	3	133466748	missense	possibly damaging	0.83
R7653:Tet2	UTSW	3	133486385	missense	probably benign	0.18
R7691:Tet2	UTSW	3	133486849	missense	probably damaging	0.98
R7770:Tet2	UTSW	3	133480295	missense	possibly damaging	0.53
R7807:Tet2	UTSW	3	133486541	missense	possibly damaging	0.53
R7813:Tet2	UTSW	3	133473643	missense	probably benign	0.06
R7978:Tet2	UTSW	3	133487665	missense	possibly damaging	0.96
R8055:Tet2	UTSW	3	133467992	missense	possibly damaging	0.93
R8164:Tet2	UTSW	3	133467134	missense	possibly damaging	0.85
R8236:Tet2	UTSW	3	133487786	missense	probably benign	0.00
R8755:Tet2	UTSW	3	133488278	missense	probably damaging	0.99
R8962:Tet2	UTSW	3	133488043	missense	probably benign	0.22
R9009:Tet2	UTSW	3	133487599	missense	possibly damaging	0.86
R9014:Tet2	UTSW	3	133467188	missense	probably damaging	0.99
R9128:Tet2	UTSW	3	133469613	missense	possibly damaging	0.85
R9166:Tet2	UTSW	3	133468172	missense	probably damaging	1.00
R9190:Tet2	UTSW	3	133481386	missense	possibly damaging	0.73
R9344:Tet2	UTSW	3	133469354	missense	possibly damaging	0.86
R9360:Tet2	UTSW	3	133487142	missense	possibly damaging	0.72
X0021:Tet2	UTSW	3	133486295	missense	possibly damaging	0.85
X0066:Tet2	UTSW	3	133488373	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGAATGACTTGATTCCTCAGGGG -3'
(R):5'- TGGAACAGCACCTGAAGCAG -3'

Sequencing Primer
(F):5'- ACTTTTGTAGGGTGATGACTGGAC -3'
(R):5'- GAAGCAGTTTCAGCTCAAGTC -3'

Posted On

2015-07-21