Incidental Mutation 'R4457:Arhgef5'
ID 329947
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor 5
Synonyms 2210412D05Rik
MMRRC Submission 041717-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4457 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 43242578-43266254 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43251027 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 593 (S593P)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably damaging
Transcript: ENSMUST00000031750
AA Change: S593P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: S593P

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203387
Meta Mutation Damage Score 0.1126 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A G 16: 90,351,260 (GRCm39) noncoding transcript Het
1700025G04Rik T C 1: 151,796,805 (GRCm39) R87G probably damaging Het
9030619P08Rik T A 15: 75,303,249 (GRCm39) noncoding transcript Het
Akap13 A G 7: 75,389,213 (GRCm39) D2377G probably damaging Het
Atp4a G A 7: 30,419,650 (GRCm39) R671Q probably benign Het
Cdkn2d C G 9: 21,202,185 (GRCm39) V21L probably benign Het
Cfap73 T C 5: 120,768,215 (GRCm39) K181R possibly damaging Het
Chn1 A G 2: 73,443,427 (GRCm39) I383T probably damaging Het
Cmtr2 A G 8: 110,948,884 (GRCm39) D398G probably benign Het
Dnah12 T C 14: 26,537,464 (GRCm39) Y2238H probably damaging Het
Dnah7c A G 1: 46,779,781 (GRCm39) N3161S probably damaging Het
Dnah8 C A 17: 31,032,125 (GRCm39) H4148Q probably benign Het
Ehbp1l1 T C 19: 5,766,321 (GRCm39) S397G possibly damaging Het
Eya4 A T 10: 22,992,566 (GRCm39) S462R probably damaging Het
Fam227b T A 2: 125,988,188 (GRCm39) probably benign Het
Frrs1 G A 3: 116,690,377 (GRCm39) V7I probably benign Het
Fsip2 G T 2: 82,821,120 (GRCm39) A5618S possibly damaging Het
Gja10 A T 4: 32,601,073 (GRCm39) M437K probably benign Het
Gm2840 T G 5: 96,322,187 (GRCm39) noncoding transcript Het
Gm4956 A G 1: 21,368,319 (GRCm39) noncoding transcript Het
Gria4 A G 9: 4,427,074 (GRCm39) W789R probably damaging Het
Hoxb5 A G 11: 96,194,546 (GRCm39) D36G probably damaging Het
Hps5 A T 7: 46,433,037 (GRCm39) C228S probably benign Het
Hspa4 A T 11: 53,171,395 (GRCm39) C270S probably damaging Het
Htra4 C A 8: 25,528,674 (GRCm39) A73S possibly damaging Het
Ikzf2 T C 1: 69,723,347 (GRCm39) probably benign Het
Ivl G A 3: 92,479,673 (GRCm39) H131Y probably benign Het
Kat6a A G 8: 23,422,129 (GRCm39) probably null Het
Lamp3 T A 16: 19,492,279 (GRCm39) M322L probably benign Het
Letmd1 T C 15: 100,373,011 (GRCm39) V37A possibly damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Myh1 G A 11: 67,111,441 (GRCm39) G1627R probably benign Het
Myo9b A G 8: 71,743,643 (GRCm39) I235V probably damaging Het
Ndor1 A G 2: 25,138,128 (GRCm39) probably null Het
Ndufa12 A T 10: 94,056,680 (GRCm39) K136M probably damaging Het
Or2t49 A G 11: 58,392,944 (GRCm39) L146P probably damaging Het
Or4a78 A T 2: 89,497,427 (GRCm39) S268T probably benign Het
Or51g2 C T 7: 102,622,734 (GRCm39) S155N probably damaging Het
Or5d44 A G 2: 88,141,173 (GRCm39) probably benign Het
Pcdha2 A G 18: 37,073,599 (GRCm39) D410G probably damaging Het
Pcyox1l T A 18: 61,830,939 (GRCm39) N311I probably benign Het
Pif1 A G 9: 65,495,058 (GRCm39) probably benign Het
Pkp1 CTCTTCTT CTCTT 1: 135,803,362 (GRCm39) probably null Het
Pogz G A 3: 94,763,374 (GRCm39) V49I probably benign Het
Rab36 G A 10: 74,880,328 (GRCm39) V63I probably damaging Het
Rnf4 A G 5: 34,508,705 (GRCm39) Y189C probably benign Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Sgms2 A C 3: 131,118,665 (GRCm39) Y273D probably damaging Het
Slc25a10 G A 11: 120,387,915 (GRCm39) V203I probably benign Het
Slc4a2 T A 5: 24,639,328 (GRCm39) probably benign Het
Tbc1d13 A G 2: 30,025,450 (GRCm39) probably benign Het
Tdrd7 A G 4: 46,007,526 (GRCm39) N526S probably benign Het
Tet2 C T 3: 133,191,324 (GRCm39) D1037N possibly damaging Het
Thrb T A 14: 18,011,187 (GRCm38) W188R probably damaging Het
Ttn T C 2: 76,777,257 (GRCm39) M1382V probably benign Het
Usp9y T A Y: 1,394,078 (GRCm39) I551L possibly damaging Het
Vwde T C 6: 13,196,100 (GRCm39) I308M probably damaging Het
Zan T C 5: 137,409,778 (GRCm39) I3488V unknown Het
Zgrf1 A T 3: 127,389,578 (GRCm39) I375F probably damaging Het
Zic4 A G 9: 91,261,315 (GRCm39) K183R probably damaging Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43,257,203 (GRCm39) nonsense probably null
IGL01341:Arhgef5 APN 6 43,260,925 (GRCm39) missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43,250,962 (GRCm39) missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43,251,538 (GRCm39) missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43,249,345 (GRCm39) missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43,252,064 (GRCm39) missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43,260,916 (GRCm39) missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43,249,869 (GRCm39) nonsense probably null
IGL03292:Arhgef5 APN 6 43,257,180 (GRCm39) missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43,250,934 (GRCm39) missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43,257,585 (GRCm39) missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43,242,555 (GRCm39) splice site probably null
R0206:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43,250,330 (GRCm39) missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43,251,568 (GRCm39) missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43,256,449 (GRCm39) missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43,250,337 (GRCm39) missense probably benign
R1663:Arhgef5 UTSW 6 43,253,899 (GRCm39) missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43,257,133 (GRCm39) missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43,265,616 (GRCm39) missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43,260,252 (GRCm39) missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43,251,354 (GRCm39) missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43,250,724 (GRCm39) missense probably benign
R4205:Arhgef5 UTSW 6 43,250,766 (GRCm39) missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43,252,033 (GRCm39) missense probably benign
R4636:Arhgef5 UTSW 6 43,251,876 (GRCm39) missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43,260,117 (GRCm39) missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43,250,484 (GRCm39) missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43,250,148 (GRCm39) missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43,250,634 (GRCm39) missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43,242,614 (GRCm39) start gained probably benign
R5251:Arhgef5 UTSW 6 43,249,815 (GRCm39) missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43,249,273 (GRCm39) missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43,250,997 (GRCm39) missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43,252,874 (GRCm39) missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43,252,038 (GRCm39) missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43,252,068 (GRCm39) missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43,251,966 (GRCm39) missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43,251,895 (GRCm39) missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43,257,933 (GRCm39) missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43,250,232 (GRCm39) missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43,251,351 (GRCm39) missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43,252,276 (GRCm39) missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43,265,665 (GRCm39) missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43,252,142 (GRCm39) missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43,250,166 (GRCm39) nonsense probably null
R7358:Arhgef5 UTSW 6 43,256,507 (GRCm39) missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43,257,216 (GRCm39) missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43,257,605 (GRCm39) nonsense probably null
R7503:Arhgef5 UTSW 6 43,250,933 (GRCm39) missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43,250,728 (GRCm39) missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43,252,069 (GRCm39) nonsense probably null
R7950:Arhgef5 UTSW 6 43,250,859 (GRCm39) missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43,260,885 (GRCm39) missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43,257,579 (GRCm39) missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43,252,933 (GRCm39) critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43,264,558 (GRCm39) missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43,260,940 (GRCm39) missense
R9610:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43,251,736 (GRCm39) missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43,250,527 (GRCm39) missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43,256,407 (GRCm39) missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43,250,635 (GRCm39) missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43,249,342 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCACCTTGTCACCTGTTAG -3'
(R):5'- AGAGTCCTGTTTCAAAGCAAAC -3'

Sequencing Primer
(F):5'- TGTCACCTGTTAGCTCTTCAG -3'
(R):5'- CTGTTTCAAAGCAAACAAAGCAGTAG -3'
Posted On 2015-07-21