Mutagenetix > Incidental Mutation

Incidental Mutation 'R4457:Atp4a'

329948

Institutional Source

Beutler Lab

Gene Symbol

Atp4a

Ensembl Gene

ENSMUSG00000005553

Gene Name

ATPase, H+/K+ exchanging, gastric, alpha polypeptide

Synonyms

H+/K+-ATPase alpha, H+K+-transporting alpha 1

MMRRC Submission

041717-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R4457 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30712209-30725534 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 30720225 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 671 (R671Q)

Ref Sequence

ENSEMBL: ENSMUSP00000131964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000005692
AA Change: R671Q

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: R671Q

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	5.4e-23	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	144	375	1.1e-57	PFAM
Pfam:Hydrolase	380	739	5.3e-16	PFAM
Pfam:HAD	383	736	1.9e-18	PFAM
Pfam:Cation_ATPase	436	531	1.6e-24	PFAM
Pfam:Cation_ATPase_C	809	1019	4.8e-43	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167761

Predicted Effect

probably benign
Transcript: ENSMUST00000170371
AA Change: R671Q

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: R671Q

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	4.9e-28	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	145	376	1e-62	PFAM
Pfam:Hydrolase	380	730	9.3e-25	PFAM
Pfam:HAD	383	727	2.1e-15	PFAM
Pfam:Hydrolase_like2	436	531	4e-25	PFAM
Pfam:Cation_ATPase_C	800	1010	1.5e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171014

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (62/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008E08Rik	A	G	16: 90,554,372		noncoding transcript	Het
1700025G04Rik	T	C	1: 151,921,054	R87G	probably damaging	Het
9030619P08Rik	T	A	15: 75,431,400		noncoding transcript	Het
Akap13	A	G	7: 75,739,465	D2377G	probably damaging	Het
Arhgef5	T	C	6: 43,274,093	S593P	probably damaging	Het
Cdkn2d	C	G	9: 21,290,889	V21L	probably benign	Het
Cfap73	T	C	5: 120,630,150	K181R	possibly damaging	Het
Chn1	A	G	2: 73,613,083	I383T	probably damaging	Het
Cmtr2	A	G	8: 110,222,252	D398G	probably benign	Het
Dnah12	T	C	14: 26,815,507	Y2238H	probably damaging	Het
Dnah7c	A	G	1: 46,740,621	N3161S	probably damaging	Het
Dnah8	C	A	17: 30,813,151	H4148Q	probably benign	Het
Ehbp1l1	T	C	19: 5,716,293	S397G	possibly damaging	Het
Eya4	A	T	10: 23,116,668	S462R	probably damaging	Het
Fam227b	T	A	2: 126,146,268		probably benign	Het
Frrs1	G	A	3: 116,896,728	V7I	probably benign	Het
Fsip2	G	T	2: 82,990,776	A5618S	possibly damaging	Het
Gja10	A	T	4: 32,601,073	M437K	probably benign	Het
Gm2840	T	G	5: 96,174,328		noncoding transcript	Het
Gm4956	A	G	1: 21,298,095		noncoding transcript	Het
Gria4	A	G	9: 4,427,074	W789R	probably damaging	Het
Hoxb5	A	G	11: 96,303,720	D36G	probably damaging	Het
Hps5	A	T	7: 46,783,613	C228S	probably benign	Het
Hspa4	A	T	11: 53,280,568	C270S	probably damaging	Het
Htra4	C	A	8: 25,038,658	A73S	possibly damaging	Het
Ikzf2	T	C	1: 69,684,188		probably benign	Het
Ivl	G	A	3: 92,572,366	H131Y	probably benign	Het
Kat6a	A	G	8: 22,932,113		probably null	Het
Lamp3	T	A	16: 19,673,529	M322L	probably benign	Het
Letmd1	T	C	15: 100,475,130	V37A	possibly damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myh1	G	A	11: 67,220,615	G1627R	probably benign	Het
Myo9b	A	G	8: 71,290,999	I235V	probably damaging	Het
Ndor1	A	G	2: 25,248,116		probably null	Het
Ndufa12	A	T	10: 94,220,818	K136M	probably damaging	Het
Olfr1174-ps	A	G	2: 88,310,829		probably benign	Het
Olfr1251	A	T	2: 89,667,083	S268T	probably benign	Het
Olfr331	A	G	11: 58,502,118	L146P	probably damaging	Het
Olfr577	C	T	7: 102,973,527	S155N	probably damaging	Het
Pcdha2	A	G	18: 36,940,546	D410G	probably damaging	Het
Pcyox1l	T	A	18: 61,697,868	N311I	probably benign	Het
Pif1	A	G	9: 65,587,776		probably benign	Het
Pkp1	CTCTTCTT	CTCTT	1: 135,875,624		probably null	Het
Pogz	G	A	3: 94,856,063	V49I	probably benign	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rnf4	A	G	5: 34,351,361	Y189C	probably benign	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Sgms2	A	C	3: 131,325,016	Y273D	probably damaging	Het
Slc25a10	G	A	11: 120,497,089	V203I	probably benign	Het
Slc4a2	T	A	5: 24,434,330		probably benign	Het
Tbc1d13	A	G	2: 30,135,438		probably benign	Het
Tdrd7	A	G	4: 46,007,526	N526S	probably benign	Het
Tet2	C	T	3: 133,485,563	D1037N	possibly damaging	Het
Thrb	T	A	14: 18,011,187	W188R	probably damaging	Het
Ttn	T	C	2: 76,946,913	M1382V	probably benign	Het
Usp9y	T	A	Y: 1,394,078	I551L	possibly damaging	Het
Vwde	T	C	6: 13,196,101	I308M	probably damaging	Het
Zan	T	C	5: 137,411,516	I3488V	unknown	Het
Zgrf1	A	T	3: 127,595,929	I375F	probably damaging	Het
Zic4	A	G	9: 91,379,262	K183R	probably damaging	Het

Other mutations in Atp4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Atp4a	APN	7	30713204	missense	possibly damaging	0.95
IGL01327:Atp4a	APN	7	30713250	missense	possibly damaging	0.96
IGL01510:Atp4a	APN	7	30720791	missense	probably benign	0.02
IGL01763:Atp4a	APN	7	30715518	missense	probably benign	0.20
IGL02061:Atp4a	APN	7	30715029	missense	probably damaging	1.00
IGL02435:Atp4a	APN	7	30717057	missense	probably benign
IGL02903:Atp4a	APN	7	30715919	missense	probably benign	0.00
IGL03181:Atp4a	APN	7	30724704	missense	probably benign	0.02
IGL03350:Atp4a	APN	7	30720867	missense	probably damaging	1.00
atypical	UTSW	7	30715356	missense	possibly damaging	0.84
sublytic	UTSW	7	30715800	missense	probably benign	0.32
IGL03097:Atp4a	UTSW	7	30723037	missense	probably benign	0.14
R0095:Atp4a	UTSW	7	30720735	missense	probably damaging	0.99
R0121:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0140:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0241:Atp4a	UTSW	7	30717135	missense	probably benign	0.00
R0437:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0624:Atp4a	UTSW	7	30718999	missense	probably benign
R1164:Atp4a	UTSW	7	30717692	missense	probably benign	0.00
R2105:Atp4a	UTSW	7	30720368	critical splice donor site	probably null
R2272:Atp4a	UTSW	7	30715500	nonsense	probably null
R2327:Atp4a	UTSW	7	30720241	missense	probably benign	0.16
R2881:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2990:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2992:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2993:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3123:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3125:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3441:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3442:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3686:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3687:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3845:Atp4a	UTSW	7	30717115	missense	probably null	0.99
R4027:Atp4a	UTSW	7	30724952	splice site	probably null
R4072:Atp4a	UTSW	7	30715332	missense	probably benign	0.09
R4433:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4454:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4458:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4510:Atp4a	UTSW	7	30724253	nonsense	probably null
R4511:Atp4a	UTSW	7	30724253	nonsense	probably null
R4576:Atp4a	UTSW	7	30717722	missense	probably benign	0.25
R4656:Atp4a	UTSW	7	30719948	intron	probably benign
R4661:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4662:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4852:Atp4a	UTSW	7	30724268	missense	probably benign	0.10
R4892:Atp4a	UTSW	7	30712474	missense	probably benign	0.07
R4907:Atp4a	UTSW	7	30719092	missense	possibly damaging	0.66
R5024:Atp4a	UTSW	7	30715864	missense	possibly damaging	0.82
R5254:Atp4a	UTSW	7	30715530	missense	probably damaging	1.00
R5318:Atp4a	UTSW	7	30715329	missense	probably damaging	1.00
R5340:Atp4a	UTSW	7	30720806	missense	probably benign
R5484:Atp4a	UTSW	7	30720672	unclassified	probably benign
R5729:Atp4a	UTSW	7	30712426	missense	possibly damaging	0.48
R5762:Atp4a	UTSW	7	30719096	missense	probably damaging	0.99
R5797:Atp4a	UTSW	7	30712649	missense	probably damaging	1.00
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6077:Atp4a	UTSW	7	30715919	missense	probably benign	0.00
R6243:Atp4a	UTSW	7	30715957	missense	possibly damaging	0.68
R6346:Atp4a	UTSW	7	30715356	missense	possibly damaging	0.84
R6459:Atp4a	UTSW	7	30712462	missense	probably benign	0.00
R6515:Atp4a	UTSW	7	30712478	missense	possibly damaging	0.78
R6773:Atp4a	UTSW	7	30715377	missense	probably damaging	0.98
R6854:Atp4a	UTSW	7	30715008	missense	probably benign	0.29
R7215:Atp4a	UTSW	7	30717360	missense	possibly damaging	0.61
R7271:Atp4a	UTSW	7	30722519	missense	probably benign	0.16
R7340:Atp4a	UTSW	7	30716730	missense	possibly damaging	0.94
R7457:Atp4a	UTSW	7	30720767	missense	probably benign	0.08
R7593:Atp4a	UTSW	7	30724680	missense	probably benign	0.08
R7712:Atp4a	UTSW	7	30715553	missense	probably damaging	0.96
R7762:Atp4a	UTSW	7	30720036	missense	probably damaging	0.96
R8714:Atp4a	UTSW	7	30720588	missense	probably damaging	0.99
R9324:Atp4a	UTSW	7	30715782	missense	probably benign	0.02
Z1177:Atp4a	UTSW	7	30717840	missense	possibly damaging	0.47
Z1186:Atp4a	UTSW	7	30717357	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCGTGGGTATCATCTCAGAG -3'
(R):5'- ATCCATGGTTAGAAAGACAGCCC -3'

Sequencing Primer
(F):5'- TATCATCTCAGAGGGCAGCG -3'
(R):5'- GACAGCCCAGCCCATCTG -3'

Posted On

2015-07-21