Incidental Mutation 'R4457:Cmtr2'
ID 329954
Institutional Source Beutler Lab
Gene Symbol Cmtr2
Ensembl Gene ENSMUSG00000046441
Gene Name cap methyltransferase 2
Synonyms Ftsjd1, C730036L12Rik
MMRRC Submission 041717-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4457 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 110942297-110951118 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110948884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 398 (D398G)
Ref Sequence ENSEMBL: ENSMUSP00000060558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056972] [ENSMUST00000189685]
AlphaFold Q8BWQ4
Predicted Effect probably benign
Transcript: ENSMUST00000056972
AA Change: D398G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000060558
Gene: ENSMUSG00000046441
AA Change: D398G

DomainStartEndE-ValueType
Pfam:FtsJ 110 320 1.7e-28 PFAM
low complexity region 550 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189685
Meta Mutation Damage Score 0.2961 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (62/64)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A G 16: 90,351,260 (GRCm39) noncoding transcript Het
1700025G04Rik T C 1: 151,796,805 (GRCm39) R87G probably damaging Het
9030619P08Rik T A 15: 75,303,249 (GRCm39) noncoding transcript Het
Akap13 A G 7: 75,389,213 (GRCm39) D2377G probably damaging Het
Arhgef5 T C 6: 43,251,027 (GRCm39) S593P probably damaging Het
Atp4a G A 7: 30,419,650 (GRCm39) R671Q probably benign Het
Cdkn2d C G 9: 21,202,185 (GRCm39) V21L probably benign Het
Cfap73 T C 5: 120,768,215 (GRCm39) K181R possibly damaging Het
Chn1 A G 2: 73,443,427 (GRCm39) I383T probably damaging Het
Dnah12 T C 14: 26,537,464 (GRCm39) Y2238H probably damaging Het
Dnah7c A G 1: 46,779,781 (GRCm39) N3161S probably damaging Het
Dnah8 C A 17: 31,032,125 (GRCm39) H4148Q probably benign Het
Ehbp1l1 T C 19: 5,766,321 (GRCm39) S397G possibly damaging Het
Eya4 A T 10: 22,992,566 (GRCm39) S462R probably damaging Het
Fam227b T A 2: 125,988,188 (GRCm39) probably benign Het
Frrs1 G A 3: 116,690,377 (GRCm39) V7I probably benign Het
Fsip2 G T 2: 82,821,120 (GRCm39) A5618S possibly damaging Het
Gja10 A T 4: 32,601,073 (GRCm39) M437K probably benign Het
Gm2840 T G 5: 96,322,187 (GRCm39) noncoding transcript Het
Gm4956 A G 1: 21,368,319 (GRCm39) noncoding transcript Het
Gria4 A G 9: 4,427,074 (GRCm39) W789R probably damaging Het
Hoxb5 A G 11: 96,194,546 (GRCm39) D36G probably damaging Het
Hps5 A T 7: 46,433,037 (GRCm39) C228S probably benign Het
Hspa4 A T 11: 53,171,395 (GRCm39) C270S probably damaging Het
Htra4 C A 8: 25,528,674 (GRCm39) A73S possibly damaging Het
Ikzf2 T C 1: 69,723,347 (GRCm39) probably benign Het
Ivl G A 3: 92,479,673 (GRCm39) H131Y probably benign Het
Kat6a A G 8: 23,422,129 (GRCm39) probably null Het
Lamp3 T A 16: 19,492,279 (GRCm39) M322L probably benign Het
Letmd1 T C 15: 100,373,011 (GRCm39) V37A possibly damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Myh1 G A 11: 67,111,441 (GRCm39) G1627R probably benign Het
Myo9b A G 8: 71,743,643 (GRCm39) I235V probably damaging Het
Ndor1 A G 2: 25,138,128 (GRCm39) probably null Het
Ndufa12 A T 10: 94,056,680 (GRCm39) K136M probably damaging Het
Or2t49 A G 11: 58,392,944 (GRCm39) L146P probably damaging Het
Or4a78 A T 2: 89,497,427 (GRCm39) S268T probably benign Het
Or51g2 C T 7: 102,622,734 (GRCm39) S155N probably damaging Het
Or5d44 A G 2: 88,141,173 (GRCm39) probably benign Het
Pcdha2 A G 18: 37,073,599 (GRCm39) D410G probably damaging Het
Pcyox1l T A 18: 61,830,939 (GRCm39) N311I probably benign Het
Pif1 A G 9: 65,495,058 (GRCm39) probably benign Het
Pkp1 CTCTTCTT CTCTT 1: 135,803,362 (GRCm39) probably null Het
Pogz G A 3: 94,763,374 (GRCm39) V49I probably benign Het
Rab36 G A 10: 74,880,328 (GRCm39) V63I probably damaging Het
Rnf4 A G 5: 34,508,705 (GRCm39) Y189C probably benign Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Sgms2 A C 3: 131,118,665 (GRCm39) Y273D probably damaging Het
Slc25a10 G A 11: 120,387,915 (GRCm39) V203I probably benign Het
Slc4a2 T A 5: 24,639,328 (GRCm39) probably benign Het
Tbc1d13 A G 2: 30,025,450 (GRCm39) probably benign Het
Tdrd7 A G 4: 46,007,526 (GRCm39) N526S probably benign Het
Tet2 C T 3: 133,191,324 (GRCm39) D1037N possibly damaging Het
Thrb T A 14: 18,011,187 (GRCm38) W188R probably damaging Het
Ttn T C 2: 76,777,257 (GRCm39) M1382V probably benign Het
Usp9y T A Y: 1,394,078 (GRCm39) I551L possibly damaging Het
Vwde T C 6: 13,196,100 (GRCm39) I308M probably damaging Het
Zan T C 5: 137,409,778 (GRCm39) I3488V unknown Het
Zgrf1 A T 3: 127,389,578 (GRCm39) I375F probably damaging Het
Zic4 A G 9: 91,261,315 (GRCm39) K183R probably damaging Het
Other mutations in Cmtr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Cmtr2 APN 8 110,949,732 (GRCm39) missense probably benign 0.02
IGL01068:Cmtr2 APN 8 110,949,501 (GRCm39) missense possibly damaging 0.65
IGL01286:Cmtr2 APN 8 110,949,484 (GRCm39) missense possibly damaging 0.95
IGL01916:Cmtr2 APN 8 110,948,580 (GRCm39) missense probably benign 0.01
IGL02302:Cmtr2 APN 8 110,948,136 (GRCm39) missense probably damaging 1.00
IGL02426:Cmtr2 APN 8 110,948,322 (GRCm39) missense possibly damaging 0.65
IGL02903:Cmtr2 APN 8 110,949,510 (GRCm39) missense probably benign 0.02
PIT4362001:Cmtr2 UTSW 8 110,948,968 (GRCm39) missense probably damaging 0.99
R1435:Cmtr2 UTSW 8 110,947,711 (GRCm39) missense probably benign
R1501:Cmtr2 UTSW 8 110,948,235 (GRCm39) missense probably benign 0.29
R1512:Cmtr2 UTSW 8 110,949,267 (GRCm39) missense probably damaging 0.99
R1709:Cmtr2 UTSW 8 110,948,581 (GRCm39) missense probably benign 0.31
R1715:Cmtr2 UTSW 8 110,949,430 (GRCm39) missense probably damaging 1.00
R1953:Cmtr2 UTSW 8 110,948,551 (GRCm39) missense probably damaging 1.00
R1960:Cmtr2 UTSW 8 110,948,382 (GRCm39) missense probably damaging 1.00
R2422:Cmtr2 UTSW 8 110,949,413 (GRCm39) missense probably benign 0.02
R3717:Cmtr2 UTSW 8 110,948,386 (GRCm39) missense probably damaging 0.96
R4043:Cmtr2 UTSW 8 110,948,462 (GRCm39) nonsense probably null
R4074:Cmtr2 UTSW 8 110,947,849 (GRCm39) missense possibly damaging 0.83
R4179:Cmtr2 UTSW 8 110,947,669 (GRCm39) splice site probably null
R4945:Cmtr2 UTSW 8 110,948,065 (GRCm39) missense probably damaging 0.99
R5371:Cmtr2 UTSW 8 110,948,044 (GRCm39) missense probably damaging 1.00
R6753:Cmtr2 UTSW 8 110,949,611 (GRCm39) missense probably damaging 1.00
R7231:Cmtr2 UTSW 8 110,949,178 (GRCm39) missense probably benign 0.02
R7527:Cmtr2 UTSW 8 110,948,770 (GRCm39) missense probably damaging 1.00
R7580:Cmtr2 UTSW 8 110,948,309 (GRCm39) missense probably damaging 0.99
R7808:Cmtr2 UTSW 8 110,948,251 (GRCm39) missense possibly damaging 0.88
R8510:Cmtr2 UTSW 8 110,949,067 (GRCm39) missense possibly damaging 0.53
R8690:Cmtr2 UTSW 8 110,948,977 (GRCm39) missense probably benign 0.00
R9172:Cmtr2 UTSW 8 110,948,761 (GRCm39) missense probably damaging 1.00
R9282:Cmtr2 UTSW 8 110,948,977 (GRCm39) missense probably benign
R9307:Cmtr2 UTSW 8 110,949,712 (GRCm39) missense probably benign 0.06
R9342:Cmtr2 UTSW 8 110,949,078 (GRCm39) missense possibly damaging 0.92
Z1177:Cmtr2 UTSW 8 110,948,131 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GATGGTGTTGAACTTCGGCAC -3'
(R):5'- TCCTCTGCCCAACTATTGAAG -3'

Sequencing Primer
(F):5'- TTGAACTTCGGCACTGAGATGAC -3'
(R):5'- GGCTACTTTATCCTTCCATGAAAGGG -3'
Posted On 2015-07-21