Incidental Mutation 'R4457:Gria4'
ID 329955
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Name glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms Gluralpha4, spkw1, Glur4, Glur-4
MMRRC Submission 041717-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.805) question?
Stock # R4457 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 4417896-4796234 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4427074 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 789 (W789R)
Ref Sequence ENSEMBL: ENSMUSP00000066980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]
AlphaFold Q9Z2W8
Predicted Effect probably benign
Transcript: ENSMUST00000027020
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000063508
AA Change: W789R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: W789R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212533
Meta Mutation Damage Score 0.9697 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A G 16: 90,554,372 noncoding transcript Het
1700025G04Rik T C 1: 151,921,054 R87G probably damaging Het
9030619P08Rik T A 15: 75,431,400 noncoding transcript Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Arhgef5 T C 6: 43,274,093 S593P probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cfap73 T C 5: 120,630,150 K181R possibly damaging Het
Chn1 A G 2: 73,613,083 I383T probably damaging Het
Cmtr2 A G 8: 110,222,252 D398G probably benign Het
Dnah12 T C 14: 26,815,507 Y2238H probably damaging Het
Dnah7c A G 1: 46,740,621 N3161S probably damaging Het
Dnah8 C A 17: 30,813,151 H4148Q probably benign Het
Ehbp1l1 T C 19: 5,716,293 S397G possibly damaging Het
Eya4 A T 10: 23,116,668 S462R probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Frrs1 G A 3: 116,896,728 V7I probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gja10 A T 4: 32,601,073 M437K probably benign Het
Gm2840 T G 5: 96,174,328 noncoding transcript Het
Gm4956 A G 1: 21,298,095 noncoding transcript Het
Hoxb5 A G 11: 96,303,720 D36G probably damaging Het
Hps5 A T 7: 46,783,613 C228S probably benign Het
Hspa4 A T 11: 53,280,568 C270S probably damaging Het
Htra4 C A 8: 25,038,658 A73S possibly damaging Het
Ikzf2 T C 1: 69,684,188 probably benign Het
Ivl G A 3: 92,572,366 H131Y probably benign Het
Kat6a A G 8: 22,932,113 probably null Het
Lamp3 T A 16: 19,673,529 M322L probably benign Het
Letmd1 T C 15: 100,475,130 V37A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh1 G A 11: 67,220,615 G1627R probably benign Het
Myo9b A G 8: 71,290,999 I235V probably damaging Het
Ndor1 A G 2: 25,248,116 probably null Het
Ndufa12 A T 10: 94,220,818 K136M probably damaging Het
Olfr1174-ps A G 2: 88,310,829 probably benign Het
Olfr1251 A T 2: 89,667,083 S268T probably benign Het
Olfr331 A G 11: 58,502,118 L146P probably damaging Het
Olfr577 C T 7: 102,973,527 S155N probably damaging Het
Pcdha2 A G 18: 36,940,546 D410G probably damaging Het
Pcyox1l T A 18: 61,697,868 N311I probably benign Het
Pif1 A G 9: 65,587,776 probably benign Het
Pkp1 CTCTTCTT CTCTT 1: 135,875,624 probably null Het
Pogz G A 3: 94,856,063 V49I probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rnf4 A G 5: 34,351,361 Y189C probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sgms2 A C 3: 131,325,016 Y273D probably damaging Het
Slc25a10 G A 11: 120,497,089 V203I probably benign Het
Slc4a2 T A 5: 24,434,330 probably benign Het
Tbc1d13 A G 2: 30,135,438 probably benign Het
Tdrd7 A G 4: 46,007,526 N526S probably benign Het
Tet2 C T 3: 133,485,563 D1037N possibly damaging Het
Thrb T A 14: 18,011,187 W188R probably damaging Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Usp9y T A Y: 1,394,078 I551L possibly damaging Het
Vwde T C 6: 13,196,101 I308M probably damaging Het
Zan T C 5: 137,411,516 I3488V unknown Het
Zgrf1 A T 3: 127,595,929 I375F probably damaging Het
Zic4 A G 9: 91,379,262 K183R probably damaging Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4472202 missense probably damaging 0.98
IGL01451:Gria4 APN 9 4503652 missense probably benign 0.04
IGL01533:Gria4 APN 9 4502395 missense probably damaging 1.00
IGL01994:Gria4 APN 9 4537726 missense probably damaging 1.00
IGL02078:Gria4 APN 9 4793878 missense probably damaging 0.98
IGL02183:Gria4 APN 9 4502460 missense probably damaging 1.00
IGL02351:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4793804 splice site probably benign
IGL03131:Gria4 APN 9 4432876 missense probably damaging 0.96
IGL03148:Gria4 APN 9 4464295 missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4513288 missense probably benign
PIT4812001:Gria4 UTSW 9 4427128 missense probably damaging 1.00
R0018:Gria4 UTSW 9 4432843 missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4793840 missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4464372 missense probably benign 0.32
R0690:Gria4 UTSW 9 4427071 missense probably damaging 1.00
R0992:Gria4 UTSW 9 4795238 missense probably benign
R1517:Gria4 UTSW 9 4793865 missense probably damaging 1.00
R1673:Gria4 UTSW 9 4537637 nonsense probably null
R1713:Gria4 UTSW 9 4424448 missense probably benign 0.20
R1961:Gria4 UTSW 9 4519546 splice site probably benign
R2137:Gria4 UTSW 9 4427026 intron probably benign
R2397:Gria4 UTSW 9 4537717 missense probably damaging 1.00
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R3014:Gria4 UTSW 9 4464294 missense probably damaging 0.97
R3412:Gria4 UTSW 9 4513278 missense probably benign 0.00
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3733:Gria4 UTSW 9 4513295 missense probably benign
R3897:Gria4 UTSW 9 4513260 missense probably damaging 1.00
R4404:Gria4 UTSW 9 4464489 splice site probably null
R4672:Gria4 UTSW 9 4664981 missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4464295 missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4472176 missense probably benign 0.01
R5109:Gria4 UTSW 9 4472168 missense probably damaging 1.00
R5202:Gria4 UTSW 9 4424330 missense probably benign 0.10
R5828:Gria4 UTSW 9 4432832 missense probably damaging 1.00
R5945:Gria4 UTSW 9 4456122 missense probably damaging 1.00
R5985:Gria4 UTSW 9 4503593 missense probably damaging 0.99
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6111:Gria4 UTSW 9 4502430 missense probably damaging 1.00
R6190:Gria4 UTSW 9 4420199 missense probably benign
R6280:Gria4 UTSW 9 4456072 missense probably damaging 1.00
R6406:Gria4 UTSW 9 4427077 missense probably damaging 1.00
R6470:Gria4 UTSW 9 4503680 missense probably damaging 1.00
R6485:Gria4 UTSW 9 4464249 missense probably damaging 1.00
R6612:Gria4 UTSW 9 4472206 missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4793822 missense probably damaging 1.00
R7046:Gria4 UTSW 9 4420278 missense probably damaging 0.97
R7210:Gria4 UTSW 9 4464135 missense probably damaging 1.00
R7284:Gria4 UTSW 9 4472017 missense probably damaging 1.00
R7475:Gria4 UTSW 9 4513330 missense probably damaging 1.00
R7501:Gria4 UTSW 9 4502436 missense probably benign 0.01
R7536:Gria4 UTSW 9 4464298 missense probably damaging 1.00
R7604:Gria4 UTSW 9 4464315 missense probably damaging 1.00
R7643:Gria4 UTSW 9 4793950 missense probably benign 0.00
R7669:Gria4 UTSW 9 4462029 missense probably damaging 1.00
R7703:Gria4 UTSW 9 4503588 missense probably benign
R7720:Gria4 UTSW 9 4464288 missense probably damaging 1.00
R7724:Gria4 UTSW 9 4472074 missense probably damaging 1.00
R7909:Gria4 UTSW 9 4464450 missense probably damaging 1.00
R8007:Gria4 UTSW 9 4503740 splice site probably benign
R8044:Gria4 UTSW 9 4456216 missense probably damaging 1.00
R8062:Gria4 UTSW 9 4480273 missense possibly damaging 0.54
R8131:Gria4 UTSW 9 4502429 missense probably benign 0.16
R8212:Gria4 UTSW 9 4480242 missense probably benign
R8478:Gria4 UTSW 9 4793882 missense probably damaging 1.00
R8699:Gria4 UTSW 9 4424347 missense probably damaging 1.00
R8699:Gria4 UTSW 9 4424351 missense probably damaging 1.00
R8785:Gria4 UTSW 9 4456106 missense probably damaging 1.00
R8785:Gria4 UTSW 9 4795189 missense possibly damaging 0.92
R8888:Gria4 UTSW 9 4664951 missense probably damaging 1.00
R8895:Gria4 UTSW 9 4664951 missense probably damaging 1.00
R9160:Gria4 UTSW 9 4424412 missense probably damaging 1.00
X0023:Gria4 UTSW 9 4427067 missense probably damaging 1.00
X0065:Gria4 UTSW 9 4464340 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCTGGGAAAGAGTTTTATTGCC -3'
(R):5'- AGTTCAAGACATAGAGCCTACTGTG -3'

Sequencing Primer
(F):5'- CTGGGAAAGAGTTTTATTGCCTATGG -3'
(R):5'- ACTGTGGCCTTTGCTCCG -3'
Posted On 2015-07-21