Mutagenetix > Incidental Mutations

Incidental Mutation 'R4457:Gria4'

329955

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

041717-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.805) question?

Stock #

R4457 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4427074 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 789 (W789R)

Ref Sequence

ENSEMBL: ENSMUSP00000066980 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]

AlphaFold

Q9Z2W8

Predicted Effect

probably benign
Transcript: ENSMUST00000027020

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000063508
AA Change: W789R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: W789R

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000212533

Meta Mutation Damage Score

0.9697

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (62/64)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008E08Rik	A	G	16: 90,554,372		noncoding transcript	Het
1700025G04Rik	T	C	1: 151,921,054	R87G	probably damaging	Het
9030619P08Rik	T	A	15: 75,431,400		noncoding transcript	Het
Akap13	A	G	7: 75,739,465	D2377G	probably damaging	Het
Arhgef5	T	C	6: 43,274,093	S593P	probably damaging	Het
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
Cdkn2d	C	G	9: 21,290,889	V21L	probably benign	Het
Cfap73	T	C	5: 120,630,150	K181R	possibly damaging	Het
Chn1	A	G	2: 73,613,083	I383T	probably damaging	Het
Cmtr2	A	G	8: 110,222,252	D398G	probably benign	Het
Dnah12	T	C	14: 26,815,507	Y2238H	probably damaging	Het
Dnah7c	A	G	1: 46,740,621	N3161S	probably damaging	Het
Dnah8	C	A	17: 30,813,151	H4148Q	probably benign	Het
Ehbp1l1	T	C	19: 5,716,293	S397G	possibly damaging	Het
Eya4	A	T	10: 23,116,668	S462R	probably damaging	Het
Fam227b	T	A	2: 126,146,268		probably benign	Het
Frrs1	G	A	3: 116,896,728	V7I	probably benign	Het
Fsip2	G	T	2: 82,990,776	A5618S	possibly damaging	Het
Gja10	A	T	4: 32,601,073	M437K	probably benign	Het
Gm2840	T	G	5: 96,174,328		noncoding transcript	Het
Gm4956	A	G	1: 21,298,095		noncoding transcript	Het
Hoxb5	A	G	11: 96,303,720	D36G	probably damaging	Het
Hps5	A	T	7: 46,783,613	C228S	probably benign	Het
Hspa4	A	T	11: 53,280,568	C270S	probably damaging	Het
Htra4	C	A	8: 25,038,658	A73S	possibly damaging	Het
Ikzf2	T	C	1: 69,684,188		probably benign	Het
Ivl	G	A	3: 92,572,366	H131Y	probably benign	Het
Kat6a	A	G	8: 22,932,113		probably null	Het
Lamp3	T	A	16: 19,673,529	M322L	probably benign	Het
Letmd1	T	C	15: 100,475,130	V37A	possibly damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myh1	G	A	11: 67,220,615	G1627R	probably benign	Het
Myo9b	A	G	8: 71,290,999	I235V	probably damaging	Het
Ndor1	A	G	2: 25,248,116		probably null	Het
Ndufa12	A	T	10: 94,220,818	K136M	probably damaging	Het
Olfr1174-ps	A	G	2: 88,310,829		probably benign	Het
Olfr1251	A	T	2: 89,667,083	S268T	probably benign	Het
Olfr331	A	G	11: 58,502,118	L146P	probably damaging	Het
Olfr577	C	T	7: 102,973,527	S155N	probably damaging	Het
Pcdha2	A	G	18: 36,940,546	D410G	probably damaging	Het
Pcyox1l	T	A	18: 61,697,868	N311I	probably benign	Het
Pif1	A	G	9: 65,587,776		probably benign	Het
Pkp1	CTCTTCTT	CTCTT	1: 135,875,624		probably null	Het
Pogz	G	A	3: 94,856,063	V49I	probably benign	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rnf4	A	G	5: 34,351,361	Y189C	probably benign	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Sgms2	A	C	3: 131,325,016	Y273D	probably damaging	Het
Slc25a10	G	A	11: 120,497,089	V203I	probably benign	Het
Slc4a2	T	A	5: 24,434,330		probably benign	Het
Tbc1d13	A	G	2: 30,135,438		probably benign	Het
Tdrd7	A	G	4: 46,007,526	N526S	probably benign	Het
Tet2	C	T	3: 133,485,563	D1037N	possibly damaging	Het
Thrb	T	A	14: 18,011,187	W188R	probably damaging	Het
Ttn	T	C	2: 76,946,913	M1382V	probably benign	Het
Usp9y	T	A	Y: 1,394,078	I551L	possibly damaging	Het
Vwde	T	C	6: 13,196,101	I308M	probably damaging	Het
Zan	T	C	5: 137,411,516	I3488V	unknown	Het
Zgrf1	A	T	3: 127,595,929	I375F	probably damaging	Het
Zic4	A	G	9: 91,379,262	K183R	probably damaging	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
PIT4812001:Gria4	UTSW	9	4427128	missense	probably damaging	1.00
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0295:Gria4	UTSW	9	4793840	missense	possibly damaging	0.69
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0690:Gria4	UTSW	9	4427071	missense	probably damaging	1.00
R0992:Gria4	UTSW	9	4795238	missense	probably benign
R1517:Gria4	UTSW	9	4793865	missense	probably damaging	1.00
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R1961:Gria4	UTSW	9	4519546	splice site	probably benign
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4672:Gria4	UTSW	9	4664981	missense	possibly damaging	0.96
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5092:Gria4	UTSW	9	4472176	missense	probably benign	0.01
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5202:Gria4	UTSW	9	4424330	missense	probably benign	0.10
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6612:Gria4	UTSW	9	4472206	missense	possibly damaging	0.93
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
R7046:Gria4	UTSW	9	4420278	missense	probably damaging	0.97
R7210:Gria4	UTSW	9	4464135	missense	probably damaging	1.00
R7284:Gria4	UTSW	9	4472017	missense	probably damaging	1.00
R7475:Gria4	UTSW	9	4513330	missense	probably damaging	1.00
R7501:Gria4	UTSW	9	4502436	missense	probably benign	0.01
R7536:Gria4	UTSW	9	4464298	missense	probably damaging	1.00
R7604:Gria4	UTSW	9	4464315	missense	probably damaging	1.00
R7643:Gria4	UTSW	9	4793950	missense	probably benign	0.00
R7669:Gria4	UTSW	9	4462029	missense	probably damaging	1.00
R7703:Gria4	UTSW	9	4503588	missense	probably benign
R7720:Gria4	UTSW	9	4464288	missense	probably damaging	1.00
R7724:Gria4	UTSW	9	4472074	missense	probably damaging	1.00
R7909:Gria4	UTSW	9	4464450	missense	probably damaging	1.00
R8007:Gria4	UTSW	9	4503740	splice site	probably benign
R8044:Gria4	UTSW	9	4456216	missense	probably damaging	1.00
R8062:Gria4	UTSW	9	4480273	missense	possibly damaging	0.54
R8131:Gria4	UTSW	9	4502429	missense	probably benign	0.16
R8212:Gria4	UTSW	9	4480242	missense	probably benign
R8478:Gria4	UTSW	9	4793882	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424347	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424351	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4456106	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4795189	missense	possibly damaging	0.92
R8888:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R8895:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R9160:Gria4	UTSW	9	4424412	missense	probably damaging	1.00
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GCTGGGAAAGAGTTTTATTGCC -3'
(R):5'- AGTTCAAGACATAGAGCCTACTGTG -3'

Sequencing Primer
(F):5'- CTGGGAAAGAGTTTTATTGCCTATGG -3'
(R):5'- ACTGTGGCCTTTGCTCCG -3'

Posted On

2015-07-21