Incidental Mutation 'R0047:Rnf219'
ID32996
Institutional Source Beutler Lab
Gene Symbol Rnf219
Ensembl Gene ENSMUSG00000022120
Gene Namering finger protein 219
Synonyms2810449K13Rik, 2610206B13Rik
MMRRC Submission 038341-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R0047 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location104477536-104522645 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to A at 104503344 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022716] [ENSMUST00000227640] [ENSMUST00000228210] [ENSMUST00000228448]
Predicted Effect probably null
Transcript: ENSMUST00000022716
SMART Domains Protein: ENSMUSP00000022716
Gene: ENSMUSG00000022120

DomainStartEndE-ValueType
RING 18 55 2.78e-3 SMART
coiled coil region 87 129 N/A INTRINSIC
coiled coil region 157 263 N/A INTRINSIC
low complexity region 302 319 N/A INTRINSIC
low complexity region 647 658 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227640
AA Change: Y214F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000228210
Predicted Effect probably null
Transcript: ENSMUST00000228448
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (98/98)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,264 T405A probably damaging Het
4932438A13Rik T A 3: 36,908,192 L481M possibly damaging Het
Acer1 A T 17: 56,955,624 D175E possibly damaging Het
Acsf2 T C 11: 94,569,342 I395V probably benign Het
Adamts9 G A 6: 92,905,306 probably benign Het
Amigo3 T C 9: 108,054,658 S427P probably benign Het
Ankrd35 A G 3: 96,684,063 K555R probably benign Het
Arhgap35 A T 7: 16,561,992 H1049Q probably benign Het
Arhgef5 G A 6: 43,265,621 probably null Het
Arid4a T G 12: 71,075,419 L858W probably damaging Het
Bbox1 A G 2: 110,268,302 F310S probably damaging Het
Bhlhe22 T C 3: 18,055,569 L261P probably damaging Het
Bmper T A 9: 23,406,686 C534S probably damaging Het
Cacna1d T G 14: 30,346,790 probably benign Het
Camk2g G A 14: 20,771,068 probably benign Het
Capn12 G A 7: 28,890,387 probably null Het
Cdkl4 T G 17: 80,550,845 N115T probably benign Het
Chchd1 T C 14: 20,704,163 S48P possibly damaging Het
Chia1 G T 3: 106,115,257 C49F probably damaging Het
Cnot7 A G 8: 40,495,921 probably benign Het
Crh T C 3: 19,694,037 E147G probably damaging Het
Cux1 T C 5: 136,363,253 probably benign Het
Cyp2b19 T A 7: 26,766,826 D351E probably benign Het
Dctn1 G T 6: 83,182,632 G31* probably null Het
Duox1 T A 2: 122,346,641 probably benign Het
Egflam T G 15: 7,253,430 E382A possibly damaging Het
Ext1 T C 15: 53,345,146 N73S probably benign Het
Ffar4 A G 19: 38,114,004 probably benign Het
Glg1 A T 8: 111,165,582 M866K probably damaging Het
Golm1 T A 13: 59,645,100 H197L probably benign Het
Gtse1 A G 15: 85,862,378 K132E probably damaging Het
Gxylt2 A T 6: 100,733,378 probably benign Het
Hrc T A 7: 45,336,689 S421R probably benign Het
Ighg2c T A 12: 113,288,168 probably benign Het
Ihh A G 1: 74,946,591 I245T probably benign Het
Ilf3 T A 9: 21,388,714 M65K possibly damaging Het
Insr A G 8: 3,202,947 V404A probably damaging Het
Irak2 G T 6: 113,672,953 probably benign Het
Irak2 G A 6: 113,678,738 V367I probably benign Het
Kat7 A C 11: 95,300,208 N119K probably benign Het
Kif9 A G 9: 110,485,038 I33V probably benign Het
Klf17 A G 4: 117,761,032 Y43H probably benign Het
Kng2 T A 16: 22,987,563 T629S possibly damaging Het
Lama1 A T 17: 67,795,186 probably benign Het
Lamb1 T C 12: 31,278,601 I188T possibly damaging Het
Lpp T A 16: 24,661,800 probably benign Het
Lrp12 T C 15: 39,878,239 E360G probably damaging Het
Mark2 A C 19: 7,283,577 probably benign Het
Mmp3 T C 9: 7,451,910 probably benign Het
Mthfd1l T A 10: 3,978,727 probably benign Het
Mtr A T 13: 12,222,226 S569T probably damaging Het
Myh13 T A 11: 67,367,237 S1752T probably benign Het
Myo5a T A 9: 75,156,207 L565H probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nfkb1 A T 3: 135,595,053 L72* probably null Het
Numa1 A G 7: 102,009,453 K296E probably damaging Het
Olfr1477 A G 19: 13,502,589 E82G probably benign Het
Olfr186 T A 16: 59,027,224 M228L probably benign Het
Olfr201 C T 16: 59,269,211 G152D probably damaging Het
Olfr508 A G 7: 108,630,552 I187V probably benign Het
Olfr613 A T 7: 103,552,322 Y179F probably damaging Het
Pcdhb5 A T 18: 37,321,268 I234F possibly damaging Het
Pgm5 T A 19: 24,684,556 I545F probably damaging Het
Pla2g2c T C 4: 138,743,590 probably benign Het
Pnpla7 A T 2: 25,011,606 E548V probably damaging Het
Ppm1m C A 9: 106,196,696 E273* probably null Het
Ppp2r1b C T 9: 50,861,573 R117* probably null Het
Rabgap1l G A 1: 160,231,789 probably benign Het
Rapgef6 T A 11: 54,546,378 M49K possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Rtel1 T G 2: 181,323,405 I146M probably damaging Het
Sdr9c7 A T 10: 127,903,672 M219L probably benign Het
Serpina3g T A 12: 104,240,284 S115T possibly damaging Het
Serpinb1a A T 13: 32,850,276 L44Q probably damaging Het
Slc13a4 A G 6: 35,287,362 I190T possibly damaging Het
Slc46a2 A G 4: 59,914,392 L177P probably damaging Het
Slc47a2 C T 11: 61,336,242 V167M possibly damaging Het
Snrnp200 C T 2: 127,234,954 probably benign Het
Snx13 C A 12: 35,101,124 probably benign Het
Snx25 C T 8: 46,041,365 A828T probably damaging Het
Spic A G 10: 88,675,941 L151P probably damaging Het
Ssu2 G A 6: 112,374,820 H315Y probably damaging Het
Stk32a T C 18: 43,313,378 probably benign Het
Tbx3 A T 5: 119,680,446 E382V probably damaging Het
Tcaf2 A G 6: 42,629,613 I469T probably benign Het
Tln2 A G 9: 67,240,672 probably benign Het
Top2a T A 11: 98,997,856 I1260L probably benign Het
Treml1 C A 17: 48,364,980 S91* probably null Het
Trim26 T C 17: 36,857,864 probably benign Het
Trmt11 T C 10: 30,535,243 N418S probably benign Het
Ttf1 A G 2: 29,084,655 Y801C probably damaging Het
Usp34 C T 11: 23,464,403 A2782V probably benign Het
Vmn2r77 T C 7: 86,811,650 V728A probably benign Het
Vps4a T C 8: 107,036,701 L29P probably damaging Het
Wdfy3 A G 5: 101,944,033 I480T probably damaging Het
Wdr41 A G 13: 95,010,287 I197V probably damaging Het
Ywhag A T 5: 135,911,299 V147E probably damaging Het
Zan A G 5: 137,403,656 M4058T unknown Het
Zfp236 C T 18: 82,680,692 C88Y probably damaging Het
Other mutations in Rnf219
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Rnf219 APN 14 104479387 nonsense probably null
IGL01731:Rnf219 APN 14 104479302 missense probably damaging 1.00
I2505:Rnf219 UTSW 14 104503449 splice site probably benign
IGL03098:Rnf219 UTSW 14 104478817 missense possibly damaging 0.93
PIT4651001:Rnf219 UTSW 14 104506256 missense probably damaging 0.99
R0047:Rnf219 UTSW 14 104503344 splice site probably null
R0394:Rnf219 UTSW 14 104478853 missense possibly damaging 0.74
R0608:Rnf219 UTSW 14 104479527 missense probably damaging 1.00
R0727:Rnf219 UTSW 14 104480188 missense probably damaging 1.00
R1109:Rnf219 UTSW 14 104479764 nonsense probably null
R1774:Rnf219 UTSW 14 104479662 missense possibly damaging 0.68
R1922:Rnf219 UTSW 14 104479186 missense probably benign 0.02
R2018:Rnf219 UTSW 14 104522542 missense probably damaging 1.00
R2061:Rnf219 UTSW 14 104522532 splice site probably benign
R2182:Rnf219 UTSW 14 104506176 missense possibly damaging 0.55
R2336:Rnf219 UTSW 14 104478882 missense probably damaging 1.00
R4308:Rnf219 UTSW 14 104479593 missense probably damaging 0.97
R4355:Rnf219 UTSW 14 104479257 missense probably benign 0.01
R4703:Rnf219 UTSW 14 104506208 missense probably benign 0.03
R4738:Rnf219 UTSW 14 104510383 missense probably damaging 1.00
R4739:Rnf219 UTSW 14 104510383 missense probably damaging 1.00
R4869:Rnf219 UTSW 14 104478816 missense probably damaging 0.99
R5025:Rnf219 UTSW 14 104508030 missense probably damaging 1.00
R5054:Rnf219 UTSW 14 104508030 missense probably damaging 1.00
R5167:Rnf219 UTSW 14 104478787 missense probably damaging 1.00
R6356:Rnf219 UTSW 14 104478877 missense probably damaging 0.99
R6427:Rnf219 UTSW 14 104480226 missense possibly damaging 0.70
R6482:Rnf219 UTSW 14 104479817 nonsense probably null
R6518:Rnf219 UTSW 14 104479065 missense probably damaging 1.00
R6619:Rnf219 UTSW 14 104522557 missense possibly damaging 0.88
R6731:Rnf219 UTSW 14 104479474 missense probably benign 0.06
R6754:Rnf219 UTSW 14 104503414 missense probably damaging 1.00
R6812:Rnf219 UTSW 14 104510432 missense unknown
R7225:Rnf219 UTSW 14 104479858 missense probably benign 0.00
R7567:Rnf219 UTSW 14 104479378 missense probably damaging 1.00
X0002:Rnf219 UTSW 14 104507977 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCAGGGGCAGGTTTATCTCA -3'
(R):5'- AGCATTGCCTATTTCAGGCTATCTGTG -3'

Sequencing Primer
(F):5'- tgctgctgctgctcttc -3'
(R):5'- CAGGCTATCTGTGATCCTGAG -3'
Posted On2013-05-09