Mutagenetix > Incidental Mutation

Incidental Mutation 'R4457:Dnah12'

329969

Institutional Source

Beutler Lab

Gene Symbol

Dnah12

Ensembl Gene

ENSMUSG00000021879

Gene Name

dynein, axonemal, heavy chain 12

Synonyms

DHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12

MMRRC Submission

041717-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.228) question?

Stock #

R4457 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

26693274-26891703 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26815507 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 2238 (Y2238H)

Ref Sequence

ENSEMBL: ENSMUSP00000022433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022433]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000022433
AA Change: Y2238H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: Y2238H

Domain	Start	End	E-Value	Type
low complexity region	127	140	N/A	INTRINSIC
coiled coil region	588	666	N/A	INTRINSIC
Pfam:DHC_N2	676	1113	1.1e-147	PFAM
AAA	1268	1407	1.15e0	SMART
Pfam:AAA_5	1552	1695	1.5e-7	PFAM
Blast:AAA	1709	1827	2e-24	BLAST
Blast:AAA	1848	1898	1e-16	BLAST
AAA	1903	2051	5.42e-4	SMART
Pfam:AAA_8	2238	2316	2e-18	PFAM

Meta Mutation Damage Score

0.1537

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (62/64)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008E08Rik	A	G	16: 90,554,372		noncoding transcript	Het
1700025G04Rik	T	C	1: 151,921,054	R87G	probably damaging	Het
9030619P08Rik	T	A	15: 75,431,400		noncoding transcript	Het
Akap13	A	G	7: 75,739,465	D2377G	probably damaging	Het
Arhgef5	T	C	6: 43,274,093	S593P	probably damaging	Het
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
Cdkn2d	C	G	9: 21,290,889	V21L	probably benign	Het
Cfap73	T	C	5: 120,630,150	K181R	possibly damaging	Het
Chn1	A	G	2: 73,613,083	I383T	probably damaging	Het
Cmtr2	A	G	8: 110,222,252	D398G	probably benign	Het
Dnah7c	A	G	1: 46,740,621	N3161S	probably damaging	Het
Dnah8	C	A	17: 30,813,151	H4148Q	probably benign	Het
Ehbp1l1	T	C	19: 5,716,293	S397G	possibly damaging	Het
Eya4	A	T	10: 23,116,668	S462R	probably damaging	Het
Fam227b	T	A	2: 126,146,268		probably benign	Het
Frrs1	G	A	3: 116,896,728	V7I	probably benign	Het
Fsip2	G	T	2: 82,990,776	A5618S	possibly damaging	Het
Gja10	A	T	4: 32,601,073	M437K	probably benign	Het
Gm2840	T	G	5: 96,174,328		noncoding transcript	Het
Gm4956	A	G	1: 21,298,095		noncoding transcript	Het
Gria4	A	G	9: 4,427,074	W789R	probably damaging	Het
Hoxb5	A	G	11: 96,303,720	D36G	probably damaging	Het
Hps5	A	T	7: 46,783,613	C228S	probably benign	Het
Hspa4	A	T	11: 53,280,568	C270S	probably damaging	Het
Htra4	C	A	8: 25,038,658	A73S	possibly damaging	Het
Ikzf2	T	C	1: 69,684,188		probably benign	Het
Ivl	G	A	3: 92,572,366	H131Y	probably benign	Het
Kat6a	A	G	8: 22,932,113		probably null	Het
Lamp3	T	A	16: 19,673,529	M322L	probably benign	Het
Letmd1	T	C	15: 100,475,130	V37A	possibly damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myh1	G	A	11: 67,220,615	G1627R	probably benign	Het
Myo9b	A	G	8: 71,290,999	I235V	probably damaging	Het
Ndor1	A	G	2: 25,248,116		probably null	Het
Ndufa12	A	T	10: 94,220,818	K136M	probably damaging	Het
Olfr1174-ps	A	G	2: 88,310,829		probably benign	Het
Olfr1251	A	T	2: 89,667,083	S268T	probably benign	Het
Olfr331	A	G	11: 58,502,118	L146P	probably damaging	Het
Olfr577	C	T	7: 102,973,527	S155N	probably damaging	Het
Pcdha2	A	G	18: 36,940,546	D410G	probably damaging	Het
Pcyox1l	T	A	18: 61,697,868	N311I	probably benign	Het
Pif1	A	G	9: 65,587,776		probably benign	Het
Pkp1	CTCTTCTT	CTCTT	1: 135,875,624		probably null	Het
Pogz	G	A	3: 94,856,063	V49I	probably benign	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rnf4	A	G	5: 34,351,361	Y189C	probably benign	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Sgms2	A	C	3: 131,325,016	Y273D	probably damaging	Het
Slc25a10	G	A	11: 120,497,089	V203I	probably benign	Het
Slc4a2	T	A	5: 24,434,330		probably benign	Het
Tbc1d13	A	G	2: 30,135,438		probably benign	Het
Tdrd7	A	G	4: 46,007,526	N526S	probably benign	Het
Tet2	C	T	3: 133,485,563	D1037N	possibly damaging	Het
Thrb	T	A	14: 18,011,187	W188R	probably damaging	Het
Ttn	T	C	2: 76,946,913	M1382V	probably benign	Het
Usp9y	T	A	Y: 1,394,078	I551L	possibly damaging	Het
Vwde	T	C	6: 13,196,101	I308M	probably damaging	Het
Zan	T	C	5: 137,411,516	I3488V	unknown	Het
Zgrf1	A	T	3: 127,595,929	I375F	probably damaging	Het
Zic4	A	G	9: 91,379,262	K183R	probably damaging	Het

Other mutations in Dnah12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01412:Dnah12	APN	14	26771005	missense	probably damaging	1.00
IGL01602:Dnah12	APN	14	26710275	splice site	probably benign
IGL01681:Dnah12	APN	14	26722160	missense	probably benign
IGL02082:Dnah12	APN	14	26707162	missense	possibly damaging	0.79
IGL02140:Dnah12	APN	14	26716577	missense	probably benign	0.20
IGL02170:Dnah12	APN	14	26773112	missense	probably damaging	0.99
IGL02174:Dnah12	APN	14	26706917	missense	probably benign	0.00
IGL02367:Dnah12	APN	14	26709161	missense	probably benign	0.30
IGL02418:Dnah12	APN	14	26773722	missense	probably damaging	1.00
IGL03039:Dnah12	APN	14	26724512	missense	probably benign	0.02
IGL03066:Dnah12	APN	14	26697398	missense	probably benign	0.06
drippings	UTSW	14	26854804	missense	probably damaging	1.00
grueben	UTSW	14	26878079	missense	probably damaging	1.00
BB010:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
BB020:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
F5770:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
FR4304:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4340:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4342:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4589:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
IGL03055:Dnah12	UTSW	14	26872740	missense	probably damaging	1.00
LCD18:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
R0003:Dnah12	UTSW	14	26772644	missense	probably damaging	1.00
R0110:Dnah12	UTSW	14	26798899	missense	probably damaging	1.00
R0302:Dnah12	UTSW	14	26799999	missense	probably damaging	1.00
R0355:Dnah12	UTSW	14	26706117	splice site	probably null
R0364:Dnah12	UTSW	14	26724473	missense	probably benign	0.10
R0469:Dnah12	UTSW	14	26798899	missense	probably damaging	1.00
R0558:Dnah12	UTSW	14	26709310	missense	probably benign	0.00
R0709:Dnah12	UTSW	14	26884265	splice site	probably benign
R0734:Dnah12	UTSW	14	26800013	missense	probably benign	0.00
R1273:Dnah12	UTSW	14	26739220	nonsense	probably null
R1496:Dnah12	UTSW	14	26710248	missense	probably benign
R1503:Dnah12	UTSW	14	26773692	missense	probably damaging	1.00
R1535:Dnah12	UTSW	14	26816322	missense	possibly damaging	0.91
R1608:Dnah12	UTSW	14	26766190	missense	probably damaging	1.00
R1682:Dnah12	UTSW	14	26778883	missense	possibly damaging	0.71
R1758:Dnah12	UTSW	14	26766114	missense	probably benign	0.02
R1826:Dnah12	UTSW	14	26711019	missense	probably benign	0.01
R1829:Dnah12	UTSW	14	26773023	missense	probably damaging	1.00
R1829:Dnah12	UTSW	14	26800075	missense	probably damaging	1.00
R1862:Dnah12	UTSW	14	26697398	missense	probably benign	0.06
R1862:Dnah12	UTSW	14	26709257	missense	probably benign	0.30
R1913:Dnah12	UTSW	14	26792264	splice site	probably null
R1933:Dnah12	UTSW	14	26734495	missense	probably damaging	0.98
R2006:Dnah12	UTSW	14	26814459	missense	possibly damaging	0.95
R2045:Dnah12	UTSW	14	26781528	missense	probably null	1.00
R2113:Dnah12	UTSW	14	26766141	missense	probably damaging	1.00
R2125:Dnah12	UTSW	14	26724458	nonsense	probably null
R2126:Dnah12	UTSW	14	26724458	nonsense	probably null
R2207:Dnah12	UTSW	14	26781787	missense	probably damaging	0.99
R2213:Dnah12	UTSW	14	26739330	missense	probably benign	0.06
R2511:Dnah12	UTSW	14	26769950	missense	possibly damaging	0.65
R2875:Dnah12	UTSW	14	26693470	missense	probably benign	0.04
R2875:Dnah12	UTSW	14	26876950	missense	probably benign	0.05
R3551:Dnah12	UTSW	14	26770972	missense	probably benign	0.01
R3713:Dnah12	UTSW	14	26812790	missense	probably benign
R3729:Dnah12	UTSW	14	26706065	missense	probably benign	0.02
R3799:Dnah12	UTSW	14	26770923	missense	probably damaging	1.00
R3846:Dnah12	UTSW	14	26710211	missense	probably benign	0.00
R3892:Dnah12	UTSW	14	26856616	missense	probably benign	0.03
R3921:Dnah12	UTSW	14	26771051	missense	probably damaging	1.00
R3940:Dnah12	UTSW	14	26723599	missense	probably benign
R4065:Dnah12	UTSW	14	26770448	missense	probably benign	0.02
R4113:Dnah12	UTSW	14	26693567	missense	probably damaging	0.98
R4249:Dnah12	UTSW	14	26709186	missense	possibly damaging	0.70
R4259:Dnah12	UTSW	14	26798926	missense	probably benign	0.01
R4260:Dnah12	UTSW	14	26798926	missense	probably benign	0.01
R4348:Dnah12	UTSW	14	26814541	missense	possibly damaging	0.94
R4490:Dnah12	UTSW	14	26734603	missense	possibly damaging	0.67
R4491:Dnah12	UTSW	14	26734603	missense	possibly damaging	0.67
R4494:Dnah12	UTSW	14	26871855	missense	probably damaging	0.99
R4523:Dnah12	UTSW	14	26770022	missense	probably damaging	0.97
R4523:Dnah12	UTSW	14	26876958	missense	possibly damaging	0.83
R4546:Dnah12	UTSW	14	26773014	missense	probably damaging	1.00
R4584:Dnah12	UTSW	14	26772594	missense	probably damaging	1.00
R4624:Dnah12	UTSW	14	26735758	missense	possibly damaging	0.82
R4689:Dnah12	UTSW	14	26706839	missense	probably benign	0.00
R4727:Dnah12	UTSW	14	26872317	missense	probably damaging	1.00
R4732:Dnah12	UTSW	14	26781784	missense	probably damaging	1.00
R4733:Dnah12	UTSW	14	26781784	missense	probably damaging	1.00
R4851:Dnah12	UTSW	14	26716629	nonsense	probably null
R4879:Dnah12	UTSW	14	26718046	critical splice donor site	probably null
R4893:Dnah12	UTSW	14	26710170	missense	possibly damaging	0.66
R4915:Dnah12	UTSW	14	26734570	missense	probably damaging	1.00
R4927:Dnah12	UTSW	14	26861805	nonsense	probably null
R4939:Dnah12	UTSW	14	26891524	missense	probably damaging	1.00
R4962:Dnah12	UTSW	14	26716700	missense	probably benign	0.00
R5011:Dnah12	UTSW	14	26710171	missense	probably benign	0.03
R5013:Dnah12	UTSW	14	26710171	missense	probably benign	0.03
R5043:Dnah12	UTSW	14	26884190	missense	probably damaging	1.00
R5049:Dnah12	UTSW	14	26735697	missense	probably benign	0.09
R5122:Dnah12	UTSW	14	26718000	missense	probably benign	0.00
R5135:Dnah12	UTSW	14	26770477	missense	probably damaging	0.99
R5149:Dnah12	UTSW	14	26850926	nonsense	probably null
R5154:Dnah12	UTSW	14	26849363	missense	probably benign	0.12
R5206:Dnah12	UTSW	14	26769985	missense	probably damaging	1.00
R5307:Dnah12	UTSW	14	26693486	missense	possibly damaging	0.49
R5330:Dnah12	UTSW	14	26773830	missense	probably damaging	1.00
R5335:Dnah12	UTSW	14	26879738	missense	probably damaging	1.00
R5339:Dnah12	UTSW	14	26814537	missense	possibly damaging	0.83
R5354:Dnah12	UTSW	14	26774342	splice site	probably null
R5389:Dnah12	UTSW	14	26735749	missense	probably damaging	1.00
R5434:Dnah12	UTSW	14	26859299	missense	probably damaging	1.00
R5466:Dnah12	UTSW	14	26771050	missense	probably damaging	1.00
R5655:Dnah12	UTSW	14	26710269	missense	probably benign	0.01
R5681:Dnah12	UTSW	14	26815495	missense	probably benign	0.32
R5824:Dnah12	UTSW	14	26770518	critical splice donor site	probably null
R5863:Dnah12	UTSW	14	26854921	missense	probably damaging	1.00
R5890:Dnah12	UTSW	14	26706884	missense	probably benign	0.09
R5912:Dnah12	UTSW	14	26770008	nonsense	probably null
R5916:Dnah12	UTSW	14	26706918	missense	possibly damaging	0.92
R5941:Dnah12	UTSW	14	26706867	missense	probably benign	0.00
R5987:Dnah12	UTSW	14	26886871	missense	possibly damaging	0.54
R5992:Dnah12	UTSW	14	26697341	missense	probably benign	0.04
R6132:Dnah12	UTSW	14	26717911	missense	probably damaging	1.00
R6136:Dnah12	UTSW	14	26875270	missense	probably damaging	0.99
R6158:Dnah12	UTSW	14	26773685	missense	possibly damaging	0.95
R6183:Dnah12	UTSW	14	26861769	missense	probably damaging	1.00
R6191:Dnah12	UTSW	14	26710257	missense	probably benign	0.03
R6235:Dnah12	UTSW	14	26854804	missense	probably damaging	1.00
R6277:Dnah12	UTSW	14	26770482	missense	probably damaging	1.00
R6332:Dnah12	UTSW	14	26717974	missense	probably damaging	0.99
R6334:Dnah12	UTSW	14	26706834	missense	possibly damaging	0.51
R6443:Dnah12	UTSW	14	26878051	missense	probably benign	0.06
R6480:Dnah12	UTSW	14	26872455	missense	probably damaging	1.00
R6530:Dnah12	UTSW	14	26735710	missense	probably damaging	1.00
R6678:Dnah12	UTSW	14	26735692	missense	probably damaging	1.00
R6709:Dnah12	UTSW	14	26872749	missense	probably damaging	1.00
R6724:Dnah12	UTSW	14	26796223	missense	probably benign	0.02
R6745:Dnah12	UTSW	14	26707228	missense	probably damaging	0.99
R6788:Dnah12	UTSW	14	26801513	missense	probably damaging	0.99
R6894:Dnah12	UTSW	14	26735749	missense	probably damaging	1.00
R6912:Dnah12	UTSW	14	26878079	missense	probably damaging	1.00
R6982:Dnah12	UTSW	14	26799076	splice site	probably null
R7001:Dnah12	UTSW	14	26879724	missense	probably damaging	0.99
R7002:Dnah12	UTSW	14	26876998	missense	probably damaging	1.00
R7017:Dnah12	UTSW	14	26735680	missense	probably benign
R7107:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7108:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7121:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7122:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7135:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7135:Dnah12	UTSW	14	26801413	missense	probably damaging	0.99
R7150:Dnah12	UTSW	14	26861732	missense	probably damaging	0.99
R7188:Dnah12	UTSW	14	26814413	missense	probably benign	0.04
R7201:Dnah12	UTSW	14	26814622	missense	probably benign	0.08
R7202:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7204:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7204:Dnah12	UTSW	14	26781485	missense	probably damaging	0.99
R7205:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7206:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7219:Dnah12	UTSW	14	26854880	missense	probably damaging	0.99
R7337:Dnah12	UTSW	14	26766577	splice site	probably null
R7339:Dnah12	UTSW	14	26872320	missense	probably benign
R7363:Dnah12	UTSW	14	26724611	missense	probably benign
R7426:Dnah12	UTSW	14	26724626	missense	probably benign	0.01
R7472:Dnah12	UTSW	14	26856635	missense	probably benign	0.01
R7579:Dnah12	UTSW	14	26770503	missense	probably benign	0.05
R7655:Dnah12	UTSW	14	26859316	missense	probably benign	0.21
R7656:Dnah12	UTSW	14	26859316	missense	probably benign	0.21
R7694:Dnah12	UTSW	14	26781380	missense	probably damaging	1.00
R7730:Dnah12	UTSW	14	26785933	missense	probably damaging	1.00
R7837:Dnah12	UTSW	14	26796219	missense	probably benign	0.01
R7855:Dnah12	UTSW	14	26829329	missense	probably benign	0.14
R7870:Dnah12	UTSW	14	26856529	missense	probably benign	0.00
R7920:Dnah12	UTSW	14	26856542	missense	possibly damaging	0.58
R7933:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
R7956:Dnah12	UTSW	14	26709272	missense	probably damaging	0.96
R8192:Dnah12	UTSW	14	26706881	missense	probably benign
R8263:Dnah12	UTSW	14	26891464	missense	noncoding transcript
R8287:Dnah12	UTSW	14	26812603	missense	probably benign
R8336:Dnah12	UTSW	14	26711065	missense	probably benign	0.01
R8362:Dnah12	UTSW	14	26854831	missense	probably damaging	1.00
R8392:Dnah12	UTSW	14	26885912	missense	probably benign
R8458:Dnah12	UTSW	14	26826892	critical splice acceptor site	probably null
R8481:Dnah12	UTSW	14	26853796	missense	probably benign	0.02
R8551:Dnah12	UTSW	14	26774270	missense	probably damaging	0.97
R8669:Dnah12	UTSW	14	26830625	splice site	probably benign
R8698:Dnah12	UTSW	14	26707263	missense	probably benign	0.02
R8709:Dnah12	UTSW	14	26693602	missense	probably benign	0.00
R8778:Dnah12	UTSW	14	26734563	missense	probably benign	0.29
R9049:Dnah12	UTSW	14	26722120	missense	probably benign	0.00
R9087:Dnah12	UTSW	14	26824546	missense	probably damaging	1.00
R9099:Dnah12	UTSW	14	26770368	missense	probably benign	0.31
R9153:Dnah12	UTSW	14	26814612	missense	probably damaging	1.00
R9177:Dnah12	UTSW	14	26849298	missense	possibly damaging	0.84
R9214:Dnah12	UTSW	14	26723905	missense	probably benign	0.02
R9268:Dnah12	UTSW	14	26849298	missense	possibly damaging	0.84
R9274:Dnah12	UTSW	14	26815417	missense	probably benign	0.00
R9293:Dnah12	UTSW	14	26773059	missense	probably benign
R9322:Dnah12	UTSW	14	26770977	missense	possibly damaging	0.75
R9353:Dnah12	UTSW	14	26856550	missense	probably damaging	1.00
R9506:Dnah12	UTSW	14	26792211	missense	probably benign	0.00
R9518:Dnah12	UTSW	14	26773756	missense	probably damaging	1.00
R9524:Dnah12	UTSW	14	26850537	missense	probably null	0.91
R9562:Dnah12	UTSW	14	26875324	missense	possibly damaging	0.58
R9565:Dnah12	UTSW	14	26875324	missense	possibly damaging	0.58
R9573:Dnah12	UTSW	14	26693464	missense	probably benign
R9581:Dnah12	UTSW	14	26770028	missense	probably damaging	1.00
R9689:Dnah12	UTSW	14	26868914	missense	probably null	1.00
R9727:Dnah12	UTSW	14	26801553	nonsense	probably null
V7580:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
V7581:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
X0018:Dnah12	UTSW	14	26814480	missense	probably damaging	1.00
X0027:Dnah12	UTSW	14	26816288	missense	probably damaging	1.00
X0065:Dnah12	UTSW	14	26814645	missense	possibly damaging	0.93
Z1177:Dnah12	UTSW	14	26875215	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATGGTACCACCTCTCATAGAC -3'
(R):5'- TTCTACAGACTAAGGGGAGGGC -3'

Sequencing Primer
(F):5'- AGGGAATCTAACGCCATCTTCTG -3'
(R):5'- CTAAGGGGAGGGCTGGCTG -3'

Posted On

2015-07-21