Incidental Mutation 'R4458:Eya1'
ID329981
Institutional Source Beutler Lab
Gene Symbol Eya1
Ensembl Gene ENSMUSG00000025932
Gene NameEYA transcriptional coactivator and phosphatase 1
Synonymsbor
MMRRC Submission 041718-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.859) question?
Stock #R4458 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location14168954-14310235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14183196 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 519 (V519M)
Ref Sequence ENSEMBL: ENSMUSP00000141112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027066] [ENSMUST00000080664] [ENSMUST00000168081] [ENSMUST00000190337]
Predicted Effect probably damaging
Transcript: ENSMUST00000027066
AA Change: V519M

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027066
Gene: ENSMUSG00000025932
AA Change: V519M

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
PDB:3HB1|D 320 591 1e-172 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000080664
AA Change: V486M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079493
Gene: ENSMUSG00000025932
AA Change: V486M

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
low complexity region 256 280 N/A INTRINSIC
PDB:3HB1|D 281 552 1e-173 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000168081
AA Change: V515M

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126383
Gene: ENSMUSG00000025932
AA Change: V515M

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 207 219 N/A INTRINSIC
low complexity region 262 286 N/A INTRINSIC
PDB:3HB1|D 287 558 1e-172 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179783
Predicted Effect probably damaging
Transcript: ENSMUST00000190337
AA Change: V519M

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141112
Gene: ENSMUSG00000025932
AA Change: V519M

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
PDB:3HB1|D 320 591 1e-172 PDB
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may play a role in the developing kidney, branchial arches, eye, and ear. Mutations of this gene have been associated with branchiootorenal dysplasia syndrome, branchiootic syndrome, and sporadic cases of congenital cataracts and ocular anterior segment anomalies. A similar protein in mice can act as a transcriptional activator. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mutations in this locus affect inner ear morphology and hearing, and result in dysmorphic or absent kidneys. Hypomorphs are deaf and circle. Null homozygotes additionally show agenesis of thymus and parathyroid and thyroid hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik G A 3: 107,232,681 probably null Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Ankrd44 A T 1: 54,762,391 I56N possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Arhgap5 T A 12: 52,517,957 N570K probably benign Het
Arid1b A T 17: 5,242,916 Q703L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cad T A 5: 31,061,226 V499D probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr2 A C 3: 108,394,997 I2605S probably damaging Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Clec18a T A 8: 111,075,470 T296S probably damaging Het
Crybg2 C T 4: 134,074,894 P1122S probably benign Het
Cyld G T 8: 88,719,301 S309I probably benign Het
Dctn5 G T 7: 122,135,080 R49L probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Erbin C A 13: 103,833,557 V1184F probably damaging Het
Ercc2 G T 7: 19,393,846 R406L probably damaging Het
Fam46a T C 9: 85,326,474 I99V possibly damaging Het
Flad1 T C 3: 89,408,934 H107R probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gabbr1 G T 17: 37,067,775 probably null Het
Haghl A T 17: 25,785,020 V30E probably damaging Het
Itga5 C T 15: 103,350,203 E822K probably damaging Het
Klhl26 T A 8: 70,452,692 E108D possibly damaging Het
Kpnb1 A T 11: 97,169,170 L558Q probably damaging Het
Lias T C 5: 65,394,040 probably null Het
Ltbp1 A T 17: 75,276,507 K434M possibly damaging Het
March1 C A 8: 66,456,171 A177E probably damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nol4 T C 18: 22,751,995 I419V probably damaging Het
Nol6 A G 4: 41,115,888 L1068P probably damaging Het
Nrcam T C 12: 44,559,730 S420P probably damaging Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pitpnm2 T C 5: 124,121,376 T1299A probably benign Het
Prdm16 A G 4: 154,322,308 V1220A probably benign Het
Saraf T C 8: 34,154,716 S25P unknown Het
Serpine3 C A 14: 62,674,473 L295I probably damaging Het
Sntb2 G A 8: 106,991,607 probably null Het
Surf6 T C 2: 26,892,709 E202G probably benign Het
Th A T 7: 142,896,953 D135E probably benign Het
Traf1 A G 2: 34,945,433 Y326H probably damaging Het
Tshz2 G A 2: 169,885,088 A66T probably benign Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Ubqlnl A G 7: 104,149,189 V367A probably benign Het
Uspl1 T A 5: 149,214,152 S707T possibly damaging Het
Utp18 A G 11: 93,870,533 S350P possibly damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn1r229 A G 17: 20,814,632 I46M probably damaging Het
Vnn3 T C 10: 23,865,669 Y291H probably benign Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Wrn T A 8: 33,294,998 T692S probably damaging Het
Yeats2 T C 16: 20,213,321 I19T probably damaging Het
Zfp13 G A 17: 23,581,176 A36V probably benign Het
Other mutations in Eya1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Eya1 APN 1 14270701 splice site probably benign
IGL01110:Eya1 APN 1 14283130 missense probably damaging 1.00
IGL02266:Eya1 APN 1 14184501 missense possibly damaging 0.63
IGL03027:Eya1 APN 1 14170966 missense probably damaging 1.00
IGL03081:Eya1 APN 1 14183191 missense possibly damaging 0.76
IGL03291:Eya1 APN 1 14184348 critical splice donor site probably null
IGL03353:Eya1 APN 1 14179527 missense probably damaging 1.00
R0042:Eya1 UTSW 1 14184489 missense probably damaging 0.98
R0042:Eya1 UTSW 1 14184489 missense probably damaging 0.98
R1428:Eya1 UTSW 1 14304414 splice site probably benign
R1521:Eya1 UTSW 1 14274550 missense probably damaging 0.99
R1571:Eya1 UTSW 1 14208917 missense probably damaging 1.00
R1768:Eya1 UTSW 1 14253075 missense possibly damaging 0.95
R1785:Eya1 UTSW 1 14170974 missense probably benign 0.16
R1840:Eya1 UTSW 1 14229504 nonsense probably null
R2114:Eya1 UTSW 1 14270774 missense probably damaging 1.00
R2131:Eya1 UTSW 1 14170974 missense probably benign 0.16
R2212:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R2416:Eya1 UTSW 1 14270703 critical splice donor site probably null
R2424:Eya1 UTSW 1 14270848 splice site probably benign
R3085:Eya1 UTSW 1 14274090 missense probably benign 0.01
R3158:Eya1 UTSW 1 14304467 start gained probably benign
R3412:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R3413:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R3693:Eya1 UTSW 1 14229501 missense probably damaging 1.00
R3694:Eya1 UTSW 1 14229501 missense probably damaging 1.00
R3899:Eya1 UTSW 1 14270747 missense probably benign 0.04
R4454:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4455:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4456:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4761:Eya1 UTSW 1 14302821 missense probably damaging 1.00
R5011:Eya1 UTSW 1 14184358 missense probably damaging 1.00
R5013:Eya1 UTSW 1 14184358 missense probably damaging 1.00
R5613:Eya1 UTSW 1 14302929 intron probably benign
R5687:Eya1 UTSW 1 14183252 missense probably damaging 0.99
R6052:Eya1 UTSW 1 14283150 missense probably damaging 1.00
R6181:Eya1 UTSW 1 14302872 missense probably damaging 0.99
R6378:Eya1 UTSW 1 14302803 missense possibly damaging 0.93
R6805:Eya1 UTSW 1 14183277 missense probably benign 0.00
R6863:Eya1 UTSW 1 14270975 intron probably null
R7032:Eya1 UTSW 1 14283200 critical splice acceptor site probably null
R7044:Eya1 UTSW 1 14231410 splice site probably null
R7078:Eya1 UTSW 1 14231412 critical splice donor site probably null
R7179:Eya1 UTSW 1 14302852 missense probably damaging 1.00
R7384:Eya1 UTSW 1 14229512 missense probably damaging 1.00
R7462:Eya1 UTSW 1 14231414 missense probably null 0.99
Z1176:Eya1 UTSW 1 14252430 missense not run
Z1176:Eya1 UTSW 1 14302868 missense not run
Z1177:Eya1 UTSW 1 14184429 missense not run
Z1177:Eya1 UTSW 1 14253090 missense not run
Predicted Primers PCR Primer
(F):5'- CCAGCAAAGTTTTATCATTCAGCTG -3'
(R):5'- ATGATCGTTCTACCTCGCAGG -3'

Sequencing Primer
(F):5'- CAAAGTTTTATCATTCAGCTGTGTGG -3'
(R):5'- TCACAGACTCCTGGCTGAC -3'
Posted On2015-07-21