Incidental Mutation 'R4458:Traf1'
ID329985
Institutional Source Beutler Lab
Gene Symbol Traf1
Ensembl Gene ENSMUSG00000026875
Gene NameTNF receptor-associated factor 1
Synonyms4732496E14Rik
MMRRC Submission 041718-MU
Accession Numbers

Genbank: NM_009421; MGI: 101836

Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R4458 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location34941750-34961772 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34945433 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 326 (Y326H)
Ref Sequence ENSEMBL: ENSMUSP00000130759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028234] [ENSMUST00000113064] [ENSMUST00000172159]
Predicted Effect probably damaging
Transcript: ENSMUST00000028234
AA Change: Y326H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028234
Gene: ENSMUSG00000026875
AA Change: Y326H

DomainStartEndE-ValueType
Pfam:TRAF_BIRC3_bd 175 238 8.4e-19 PFAM
MATH 264 386 8.29e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113064
AA Change: Y326H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108687
Gene: ENSMUSG00000026875
AA Change: Y326H

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
MATH 264 386 8.29e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129131
Predicted Effect probably damaging
Transcript: ENSMUST00000172159
AA Change: Y326H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130759
Gene: ENSMUSG00000026875
AA Change: Y326H

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
MATH 264 386 8.29e-20 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor (TNFR) associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from various receptors of the TNFR superfamily. This protein and TRAF2 form a heterodimeric complex, which is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF2 also interacts with inhibitor-of-apoptosis proteins (IAPs), and thus mediates the anti-apoptotic signals from TNF receptors. The expression of this protein can be induced by Epstein-Barr virus (EBV). EBV infection membrane protein 1 (LMP1) is found to interact with this and other TRAF proteins; this interaction is thought to link LMP1-mediated B lymphocyte transformation to the signal transduction from TNFR family receptors. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mice exhibit abnormal T cell functionality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik G A 3: 107,232,681 probably null Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Ankrd44 A T 1: 54,762,391 I56N possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Arhgap5 T A 12: 52,517,957 N570K probably benign Het
Arid1b A T 17: 5,242,916 Q703L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cad T A 5: 31,061,226 V499D probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr2 A C 3: 108,394,997 I2605S probably damaging Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Clec18a T A 8: 111,075,470 T296S probably damaging Het
Crybg2 C T 4: 134,074,894 P1122S probably benign Het
Cyld G T 8: 88,719,301 S309I probably benign Het
Dctn5 G T 7: 122,135,080 R49L probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Erbin C A 13: 103,833,557 V1184F probably damaging Het
Ercc2 G T 7: 19,393,846 R406L probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam46a T C 9: 85,326,474 I99V possibly damaging Het
Flad1 T C 3: 89,408,934 H107R probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gabbr1 G T 17: 37,067,775 probably null Het
Haghl A T 17: 25,785,020 V30E probably damaging Het
Itga5 C T 15: 103,350,203 E822K probably damaging Het
Klhl26 T A 8: 70,452,692 E108D possibly damaging Het
Kpnb1 A T 11: 97,169,170 L558Q probably damaging Het
Lias T C 5: 65,394,040 probably null Het
Ltbp1 A T 17: 75,276,507 K434M possibly damaging Het
March1 C A 8: 66,456,171 A177E probably damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nol4 T C 18: 22,751,995 I419V probably damaging Het
Nol6 A G 4: 41,115,888 L1068P probably damaging Het
Nrcam T C 12: 44,559,730 S420P probably damaging Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pitpnm2 T C 5: 124,121,376 T1299A probably benign Het
Prdm16 A G 4: 154,322,308 V1220A probably benign Het
Saraf T C 8: 34,154,716 S25P unknown Het
Serpine3 C A 14: 62,674,473 L295I probably damaging Het
Sntb2 G A 8: 106,991,607 probably null Het
Surf6 T C 2: 26,892,709 E202G probably benign Het
Th A T 7: 142,896,953 D135E probably benign Het
Tshz2 G A 2: 169,885,088 A66T probably benign Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Ubqlnl A G 7: 104,149,189 V367A probably benign Het
Uspl1 T A 5: 149,214,152 S707T possibly damaging Het
Utp18 A G 11: 93,870,533 S350P possibly damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn1r229 A G 17: 20,814,632 I46M probably damaging Het
Vnn3 T C 10: 23,865,669 Y291H probably benign Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Wrn T A 8: 33,294,998 T692S probably damaging Het
Yeats2 T C 16: 20,213,321 I19T probably damaging Het
Zfp13 G A 17: 23,581,176 A36V probably benign Het
Other mutations in Traf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Traf1 APN 2 34943893 missense probably benign 0.00
IGL01993:Traf1 APN 2 34946867 splice site probably benign
IGL02429:Traf1 APN 2 34949103 missense probably benign
IGL02752:Traf1 APN 2 34958008 missense probably benign 0.00
IGL02933:Traf1 APN 2 34949095 missense possibly damaging 0.55
IGL03346:Traf1 APN 2 34948472 missense probably benign 0.01
3-1:Traf1 UTSW 2 34949106 critical splice acceptor site probably null
R0220:Traf1 UTSW 2 34949103 missense probably benign
R2064:Traf1 UTSW 2 34948190 missense probably benign 0.07
R4797:Traf1 UTSW 2 34956277 missense probably benign 0.17
R5398:Traf1 UTSW 2 34945435 missense probably damaging 1.00
R6221:Traf1 UTSW 2 34948301 missense probably benign 0.45
R6584:Traf1 UTSW 2 34958058 missense probably damaging 1.00
R6792:Traf1 UTSW 2 34956275 missense probably benign 0.00
R7350:Traf1 UTSW 2 34948233 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CGGGATTTGCATTCGGCTTC -3'
(R):5'- CCTCAGCACTTTCCTAGAGAAG -3'

Sequencing Primer
(F):5'- GCATTCGGCTTCATTTTATAGAAGG -3'
(R):5'- CACTTTCCTAGAGAAGAGGGCTG -3'
Posted On2015-07-21