Incidental Mutation 'R4458:Chd6'
ID329989
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Namechromodomain helicase DNA binding protein 6
Synonyms6330406J24Rik, 5430439G14Rik
MMRRC Submission 041718-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.790) question?
Stock #R4458 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location160946978-161109075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 161029876 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 213 (Y213F)
Ref Sequence ENSEMBL: ENSMUSP00000117075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000130265] [ENSMUST00000134178]
Predicted Effect probably benign
Transcript: ENSMUST00000039782
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130265
AA Change: Y213F

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117075
Gene: ENSMUSG00000057133
AA Change: Y213F

DomainStartEndE-ValueType
low complexity region 1 23 N/A INTRINSIC
Blast:CHROMO 26 210 4e-80 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000134178
SMART Domains Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
CHROMO 288 354 1.35e-4 SMART
CHROMO 371 429 3.48e-7 SMART
DEXDc 455 657 1.73e-39 SMART
HELICc 811 895 3.84e-23 SMART
low complexity region 1079 1093 N/A INTRINSIC
Blast:DEXDc 1107 1152 4e-23 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155066
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik G A 3: 107,232,681 probably null Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Ankrd44 A T 1: 54,762,391 I56N possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Arhgap5 T A 12: 52,517,957 N570K probably benign Het
Arid1b A T 17: 5,242,916 Q703L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cad T A 5: 31,061,226 V499D probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr2 A C 3: 108,394,997 I2605S probably damaging Het
Clec18a T A 8: 111,075,470 T296S probably damaging Het
Crybg2 C T 4: 134,074,894 P1122S probably benign Het
Cyld G T 8: 88,719,301 S309I probably benign Het
Dctn5 G T 7: 122,135,080 R49L probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Erbin C A 13: 103,833,557 V1184F probably damaging Het
Ercc2 G T 7: 19,393,846 R406L probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam46a T C 9: 85,326,474 I99V possibly damaging Het
Flad1 T C 3: 89,408,934 H107R probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gabbr1 G T 17: 37,067,775 probably null Het
Haghl A T 17: 25,785,020 V30E probably damaging Het
Itga5 C T 15: 103,350,203 E822K probably damaging Het
Klhl26 T A 8: 70,452,692 E108D possibly damaging Het
Kpnb1 A T 11: 97,169,170 L558Q probably damaging Het
Lias T C 5: 65,394,040 probably null Het
Ltbp1 A T 17: 75,276,507 K434M possibly damaging Het
March1 C A 8: 66,456,171 A177E probably damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nol4 T C 18: 22,751,995 I419V probably damaging Het
Nol6 A G 4: 41,115,888 L1068P probably damaging Het
Nrcam T C 12: 44,559,730 S420P probably damaging Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pitpnm2 T C 5: 124,121,376 T1299A probably benign Het
Prdm16 A G 4: 154,322,308 V1220A probably benign Het
Saraf T C 8: 34,154,716 S25P unknown Het
Serpine3 C A 14: 62,674,473 L295I probably damaging Het
Sntb2 G A 8: 106,991,607 probably null Het
Surf6 T C 2: 26,892,709 E202G probably benign Het
Th A T 7: 142,896,953 D135E probably benign Het
Traf1 A G 2: 34,945,433 Y326H probably damaging Het
Tshz2 G A 2: 169,885,088 A66T probably benign Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Ubqlnl A G 7: 104,149,189 V367A probably benign Het
Uspl1 T A 5: 149,214,152 S707T possibly damaging Het
Utp18 A G 11: 93,870,533 S350P possibly damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn1r229 A G 17: 20,814,632 I46M probably damaging Het
Vnn3 T C 10: 23,865,669 Y291H probably benign Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Wrn T A 8: 33,294,998 T692S probably damaging Het
Yeats2 T C 16: 20,213,321 I19T probably damaging Het
Zfp13 G A 17: 23,581,176 A36V probably benign Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 161042079 missense probably benign 0.01
IGL00899:Chd6 APN 2 161029298 splice site probably benign
IGL01104:Chd6 APN 2 160961927 missense probably damaging 1.00
IGL01295:Chd6 APN 2 160988370 splice site probably benign
IGL01717:Chd6 APN 2 160965259 missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160961374 missense probably benign 0.00
IGL01814:Chd6 APN 2 161059929 missense probably benign 0.25
IGL02016:Chd6 APN 2 160983678 missense probably damaging 1.00
IGL02104:Chd6 APN 2 160977512 missense probably benign
IGL02158:Chd6 APN 2 161026292 missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160965675 missense probably damaging 1.00
IGL02472:Chd6 APN 2 160984452 splice site probably benign
IGL02522:Chd6 APN 2 160965796 missense probably benign 0.30
IGL02626:Chd6 APN 2 161039350 splice site probably benign
IGL02727:Chd6 APN 2 160969463 missense probably damaging 0.96
IGL02738:Chd6 APN 2 160965698 missense probably benign 0.45
IGL02743:Chd6 APN 2 160960263 missense probably damaging 1.00
IGL02800:Chd6 APN 2 160984632 missense probably damaging 1.00
IGL02811:Chd6 APN 2 160990301 missense probably damaging 1.00
IGL02850:Chd6 APN 2 161019616 nonsense probably null
IGL02979:Chd6 APN 2 160966170 missense possibly damaging 0.48
IGL02993:Chd6 APN 2 161052384 splice site probably benign
IGL03277:Chd6 APN 2 160983061 missense probably null 1.00
IGL03346:Chd6 APN 2 160960362 missense probably benign 0.00
IGL03357:Chd6 APN 2 161018016 splice site probably benign
IGL03134:Chd6 UTSW 2 160965483 missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0212:Chd6 UTSW 2 161052847 missense probably damaging 0.99
R0363:Chd6 UTSW 2 161014324 missense probably damaging 1.00
R0399:Chd6 UTSW 2 161052688 missense probably damaging 1.00
R0511:Chd6 UTSW 2 160992191 missense probably damaging 0.99
R0771:Chd6 UTSW 2 161019580 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1184:Chd6 UTSW 2 161030802 missense probably damaging 1.00
R1277:Chd6 UTSW 2 160967815 missense probably damaging 1.00
R1396:Chd6 UTSW 2 160983103 missense probably damaging 1.00
R1647:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1648:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1745:Chd6 UTSW 2 160981667 missense probably damaging 0.96
R1766:Chd6 UTSW 2 160966639 missense probably damaging 1.00
R1871:Chd6 UTSW 2 160990256 missense probably damaging 1.00
R1928:Chd6 UTSW 2 160968000 splice site probably benign
R1973:Chd6 UTSW 2 160966387 missense probably damaging 0.99
R2200:Chd6 UTSW 2 160983753 missense probably damaging 1.00
R2340:Chd6 UTSW 2 160965759 frame shift probably null
R2341:Chd6 UTSW 2 160965759 frame shift probably null
R2519:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160967880 missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160966552 small deletion probably benign
R3426:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R3427:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R4042:Chd6 UTSW 2 160988333 missense probably damaging 1.00
R4273:Chd6 UTSW 2 160961291 missense probably benign 0.04
R4360:Chd6 UTSW 2 160949856 missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160965318 missense probably benign
R4583:Chd6 UTSW 2 161014194 missense probably damaging 1.00
R4625:Chd6 UTSW 2 160969492 missense probably damaging 1.00
R4740:Chd6 UTSW 2 160970183 missense probably benign
R4765:Chd6 UTSW 2 160966244 nonsense probably null
R4779:Chd6 UTSW 2 160949557 missense probably damaging 1.00
R4877:Chd6 UTSW 2 161029299 splice site probably benign
R5068:Chd6 UTSW 2 160966369 missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160949953 missense probably damaging 1.00
R5275:Chd6 UTSW 2 160969363 missense probably benign
R5405:Chd6 UTSW 2 160965390 missense probably benign
R5598:Chd6 UTSW 2 161014112 missense probably damaging 1.00
R5693:Chd6 UTSW 2 160965265 missense probably benign
R5697:Chd6 UTSW 2 161018051 missense probably damaging 1.00
R5715:Chd6 UTSW 2 160949878 missense probably benign 0.00
R5759:Chd6 UTSW 2 160983762 missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160957078 missense probably damaging 1.00
R5761:Chd6 UTSW 2 160957079 missense probably damaging 1.00
R5954:Chd6 UTSW 2 160965827 missense probably benign 0.00
R6025:Chd6 UTSW 2 160965582 missense probably benign
R6104:Chd6 UTSW 2 161014132 missense probably damaging 1.00
R6247:Chd6 UTSW 2 160950048 missense probably damaging 1.00
R6393:Chd6 UTSW 2 160979487 missense probably damaging 1.00
R6452:Chd6 UTSW 2 160965498 missense possibly damaging 0.76
R6468:Chd6 UTSW 2 161013067 missense probably damaging 1.00
R6784:Chd6 UTSW 2 160966254 missense probably damaging 1.00
R6803:Chd6 UTSW 2 160960359 missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160965730 missense probably benign
R6895:Chd6 UTSW 2 160988340 missense probably damaging 1.00
R6925:Chd6 UTSW 2 161013127 missense probably damaging 0.98
R7061:Chd6 UTSW 2 161025965 nonsense probably null
R7064:Chd6 UTSW 2 160950063 missense probably damaging 1.00
R7248:Chd6 UTSW 2 160961279 nonsense probably null
R7287:Chd6 UTSW 2 161008392 missense probably benign 0.07
R7431:Chd6 UTSW 2 161026328 missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160950003 missense probably damaging 1.00
R7509:Chd6 UTSW 2 161013154 missense probably damaging 1.00
R7748:Chd6 UTSW 2 160966619 missense probably benign 0.37
R7785:Chd6 UTSW 2 160970175 missense possibly damaging 0.51
Z1088:Chd6 UTSW 2 160966488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTGAATGTAGGCAGGTAGC -3'
(R):5'- TCCCTCCTAAAATGAGGCATAG -3'

Sequencing Primer
(F):5'- AAACTTGTCAGTCCTCAGGG -3'
(R):5'- CCTCCTAAAATGAGGCATAGGTATTG -3'
Posted On2015-07-21