Incidental Mutation 'R4458:Celsr2'
ID329994
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Namecadherin, EGF LAG seven-pass G-type receptor 2
Synonymsmfmi1, EGFL2, flamingo
MMRRC Submission 041718-MU
Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4458 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108390851-108415552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108394997 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 2605 (I2605S)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558]
Predicted Effect probably damaging
Transcript: ENSMUST00000090558
AA Change: I2605S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: I2605S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133216
Predicted Effect unknown
Transcript: ENSMUST00000147251
AA Change: I593S
SMART Domains Protein: ENSMUSP00000122329
Gene: ENSMUSG00000068740
AA Change: I593S

DomainStartEndE-ValueType
Pfam:GAIN 35 278 5.1e-63 PFAM
GPS 304 357 1.86e-25 SMART
Pfam:7tm_2 362 594 2e-49 PFAM
low complexity region 704 722 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 863 870 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik G A 3: 107,232,681 probably null Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Ankrd44 A T 1: 54,762,391 I56N possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Arhgap5 T A 12: 52,517,957 N570K probably benign Het
Arid1b A T 17: 5,242,916 Q703L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cad T A 5: 31,061,226 V499D probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Clec18a T A 8: 111,075,470 T296S probably damaging Het
Crybg2 C T 4: 134,074,894 P1122S probably benign Het
Cyld G T 8: 88,719,301 S309I probably benign Het
Dctn5 G T 7: 122,135,080 R49L probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Erbin C A 13: 103,833,557 V1184F probably damaging Het
Ercc2 G T 7: 19,393,846 R406L probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam46a T C 9: 85,326,474 I99V possibly damaging Het
Flad1 T C 3: 89,408,934 H107R probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gabbr1 G T 17: 37,067,775 probably null Het
Haghl A T 17: 25,785,020 V30E probably damaging Het
Itga5 C T 15: 103,350,203 E822K probably damaging Het
Klhl26 T A 8: 70,452,692 E108D possibly damaging Het
Kpnb1 A T 11: 97,169,170 L558Q probably damaging Het
Lias T C 5: 65,394,040 probably null Het
Ltbp1 A T 17: 75,276,507 K434M possibly damaging Het
March1 C A 8: 66,456,171 A177E probably damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nol4 T C 18: 22,751,995 I419V probably damaging Het
Nol6 A G 4: 41,115,888 L1068P probably damaging Het
Nrcam T C 12: 44,559,730 S420P probably damaging Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pitpnm2 T C 5: 124,121,376 T1299A probably benign Het
Prdm16 A G 4: 154,322,308 V1220A probably benign Het
Saraf T C 8: 34,154,716 S25P unknown Het
Serpine3 C A 14: 62,674,473 L295I probably damaging Het
Sntb2 G A 8: 106,991,607 probably null Het
Surf6 T C 2: 26,892,709 E202G probably benign Het
Th A T 7: 142,896,953 D135E probably benign Het
Traf1 A G 2: 34,945,433 Y326H probably damaging Het
Tshz2 G A 2: 169,885,088 A66T probably benign Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Ubqlnl A G 7: 104,149,189 V367A probably benign Het
Uspl1 T A 5: 149,214,152 S707T possibly damaging Het
Utp18 A G 11: 93,870,533 S350P possibly damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn1r229 A G 17: 20,814,632 I46M probably damaging Het
Vnn3 T C 10: 23,865,669 Y291H probably benign Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Wrn T A 8: 33,294,998 T692S probably damaging Het
Yeats2 T C 16: 20,213,321 I19T probably damaging Het
Zfp13 G A 17: 23,581,176 A36V probably benign Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108413879 missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108403270 missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108393763 missense probably benign 0.13
IGL01448:Celsr2 APN 3 108393239 missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108406867 missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108414843 missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108394022 missense probably benign 0.00
IGL02309:Celsr2 APN 3 108396011 missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108412871 missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108413955 missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108397510 missense probably benign 0.01
IGL02812:Celsr2 APN 3 108414113 missense probably benign 0.25
IGL02894:Celsr2 APN 3 108395210 missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108412940 missense probably damaging 1.00
barrow UTSW 3 108394965 missense possibly damaging 0.92
goldeneye UTSW 3 108394919 missense probably damaging 1.00
1mM(1):Celsr2 UTSW 3 108400838 missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108412499 missense probably damaging 1.00
IGL02799:Celsr2 UTSW 3 108414062 missense probably damaging 1.00
R0011:Celsr2 UTSW 3 108413402 missense probably benign 0.19
R0031:Celsr2 UTSW 3 108413063 missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0090:Celsr2 UTSW 3 108393327 splice site probably benign
R0140:Celsr2 UTSW 3 108397933 missense probably benign 0.00
R0524:Celsr2 UTSW 3 108401587 missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108403895 critical splice donor site probably null
R0662:Celsr2 UTSW 3 108398520 missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108414977 missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108412623 missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108412712 missense probably benign 0.42
R0730:Celsr2 UTSW 3 108398606 missense probably damaging 1.00
R0815:Celsr2 UTSW 3 108401301 missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108414338 missense probably benign
R0989:Celsr2 UTSW 3 108403272 missense probably benign 0.00
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1474:Celsr2 UTSW 3 108393739 missense possibly damaging 0.91
R1608:Celsr2 UTSW 3 108402483 missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108413520 missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108414095 missense probably benign
R1689:Celsr2 UTSW 3 108407304 missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108401310 missense probably benign 0.35
R1859:Celsr2 UTSW 3 108396630 missense probably damaging 1.00
R1918:Celsr2 UTSW 3 108398650 missense probably benign 0.05
R1974:Celsr2 UTSW 3 108414214 missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108402495 missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108413193 missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108398605 missense probably benign 0.16
R2434:Celsr2 UTSW 3 108404479 missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108413591 missense probably benign 0.11
R3420:Celsr2 UTSW 3 108414416 missense probably benign 0.03
R3712:Celsr2 UTSW 3 108400839 missense probably benign
R3723:Celsr2 UTSW 3 108397415 splice site probably benign
R3809:Celsr2 UTSW 3 108403239 missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108394965 missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108402097 missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108413978 missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108413772 missense probably benign 0.02
R4293:Celsr2 UTSW 3 108393677 missense probably benign 0.01
R4621:Celsr2 UTSW 3 108395216 missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108395969 missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108397231 missense probably benign 0.24
R4732:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108406987 missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108402758 missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108412629 missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108412358 missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108413373 missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108393996 missense probably benign 0.05
R5120:Celsr2 UTSW 3 108393120 missense probably benign 0.02
R5135:Celsr2 UTSW 3 108398659 missense probably damaging 1.00
R5247:Celsr2 UTSW 3 108397630 missense probably benign 0.34
R5381:Celsr2 UTSW 3 108402757 missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108399995 missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108392658 missense probably benign 0.01
R5528:Celsr2 UTSW 3 108413294 missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108402803 missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108396735 missense probably null 0.49
R5697:Celsr2 UTSW 3 108403921 nonsense probably null
R5718:Celsr2 UTSW 3 108393358 missense probably benign
R5869:Celsr2 UTSW 3 108413909 missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108413943 missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108401245 missense probably benign
R6054:Celsr2 UTSW 3 108406963 missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108393128 missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108401214 missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108412574 missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108394919 missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108400501 critical splice donor site probably null
R7062:Celsr2 UTSW 3 108402510 missense possibly damaging 0.95
R7110:Celsr2 UTSW 3 108397865 missense probably damaging 1.00
R7139:Celsr2 UTSW 3 108415359 missense unknown
R7326:Celsr2 UTSW 3 108394995 missense possibly damaging 0.85
R7425:Celsr2 UTSW 3 108402457 missense probably damaging 1.00
R7452:Celsr2 UTSW 3 108413090 missense possibly damaging 0.95
R7461:Celsr2 UTSW 3 108395640 missense probably damaging 1.00
R7502:Celsr2 UTSW 3 108398902 missense probably benign 0.00
X0020:Celsr2 UTSW 3 108396110 missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108401272 missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108414117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCCTAACATGAAGGTGTGC -3'
(R):5'- ACTGCTCTCTGTCAACAGTG -3'

Sequencing Primer
(F):5'- CCTAACATGAAGGTGTGCAGAGATG -3'
(R):5'- TCAACAGTGACACTCTGCTC -3'
Posted On2015-07-21