Incidental Mutation 'R4458:Nol6'
ID329995
Institutional Source Beutler Lab
Gene Symbol Nol6
Ensembl Gene ENSMUSG00000028430
Gene Namenucleolar protein family 6 (RNA-associated)
SynonymsNrap
MMRRC Submission 041718-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R4458 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location41114427-41124455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41115888 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1068 (L1068P)
Ref Sequence ENSEMBL: ENSMUSP00000030138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030138]
Predicted Effect probably damaging
Transcript: ENSMUST00000030138
AA Change: L1068P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030138
Gene: ENSMUSG00000028430
AA Change: L1068P

DomainStartEndE-ValueType
Pfam:Nrap 174 1145 5e-287 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nucleolus is a dense subnuclear membraneless organelle that assembles around clusters of rRNA genes and functions in ribosome biogenesis. This gene encodes a nucleolar RNA-associated protein that is highly conserved between species. RNase treatment of permeabilized cells indicates that the nucleolar localization is RNA dependent. Further studies suggest that the protein is associated with ribosome biogenesis through an interaction with pre-rRNA primary transcripts. Alternative splicing has been observed at this locus and two splice variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik G A 3: 107,232,681 probably null Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Ankrd44 A T 1: 54,762,391 I56N possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Arhgap5 T A 12: 52,517,957 N570K probably benign Het
Arid1b A T 17: 5,242,916 Q703L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cad T A 5: 31,061,226 V499D probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr2 A C 3: 108,394,997 I2605S probably damaging Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Clec18a T A 8: 111,075,470 T296S probably damaging Het
Crybg2 C T 4: 134,074,894 P1122S probably benign Het
Cyld G T 8: 88,719,301 S309I probably benign Het
Dctn5 G T 7: 122,135,080 R49L probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Erbin C A 13: 103,833,557 V1184F probably damaging Het
Ercc2 G T 7: 19,393,846 R406L probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam46a T C 9: 85,326,474 I99V possibly damaging Het
Flad1 T C 3: 89,408,934 H107R probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gabbr1 G T 17: 37,067,775 probably null Het
Haghl A T 17: 25,785,020 V30E probably damaging Het
Itga5 C T 15: 103,350,203 E822K probably damaging Het
Klhl26 T A 8: 70,452,692 E108D possibly damaging Het
Kpnb1 A T 11: 97,169,170 L558Q probably damaging Het
Lias T C 5: 65,394,040 probably null Het
Ltbp1 A T 17: 75,276,507 K434M possibly damaging Het
March1 C A 8: 66,456,171 A177E probably damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nol4 T C 18: 22,751,995 I419V probably damaging Het
Nrcam T C 12: 44,559,730 S420P probably damaging Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pitpnm2 T C 5: 124,121,376 T1299A probably benign Het
Prdm16 A G 4: 154,322,308 V1220A probably benign Het
Saraf T C 8: 34,154,716 S25P unknown Het
Serpine3 C A 14: 62,674,473 L295I probably damaging Het
Sntb2 G A 8: 106,991,607 probably null Het
Surf6 T C 2: 26,892,709 E202G probably benign Het
Th A T 7: 142,896,953 D135E probably benign Het
Traf1 A G 2: 34,945,433 Y326H probably damaging Het
Tshz2 G A 2: 169,885,088 A66T probably benign Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Ubqlnl A G 7: 104,149,189 V367A probably benign Het
Uspl1 T A 5: 149,214,152 S707T possibly damaging Het
Utp18 A G 11: 93,870,533 S350P possibly damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn1r229 A G 17: 20,814,632 I46M probably damaging Het
Vnn3 T C 10: 23,865,669 Y291H probably benign Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Wrn T A 8: 33,294,998 T692S probably damaging Het
Yeats2 T C 16: 20,213,321 I19T probably damaging Het
Zfp13 G A 17: 23,581,176 A36V probably benign Het
Other mutations in Nol6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nol6 APN 4 41123374 missense possibly damaging 0.89
IGL00787:Nol6 APN 4 41122198 missense probably benign 0.10
IGL01062:Nol6 APN 4 41118205 missense probably benign 0.13
IGL01113:Nol6 APN 4 41115749 missense probably damaging 1.00
IGL01874:Nol6 APN 4 41115412 missense probably damaging 1.00
IGL01995:Nol6 APN 4 41118567 missense probably damaging 1.00
IGL02060:Nol6 APN 4 41117700 missense probably damaging 1.00
IGL03082:Nol6 APN 4 41115878 splice site probably benign
IGL03221:Nol6 APN 4 41124166 missense probably benign 0.00
IGL03332:Nol6 APN 4 41120735 missense probably damaging 1.00
leaky UTSW 4 41118154 missense probably benign 0.02
R0066:Nol6 UTSW 4 41119572 splice site probably benign
R0066:Nol6 UTSW 4 41119572 splice site probably benign
R0308:Nol6 UTSW 4 41123584 missense probably benign 0.01
R0632:Nol6 UTSW 4 41121115 missense probably damaging 0.96
R1222:Nol6 UTSW 4 41120760 missense probably benign 0.01
R1471:Nol6 UTSW 4 41120281 missense probably benign 0.00
R1481:Nol6 UTSW 4 41123596 missense probably benign 0.00
R1971:Nol6 UTSW 4 41119542 missense probably damaging 1.00
R2191:Nol6 UTSW 4 41118720 missense probably benign 0.00
R2495:Nol6 UTSW 4 41118427 missense probably damaging 1.00
R3852:Nol6 UTSW 4 41117452 missense probably damaging 0.99
R3923:Nol6 UTSW 4 41121531 missense probably benign 0.17
R4510:Nol6 UTSW 4 41123526 missense probably damaging 1.00
R4511:Nol6 UTSW 4 41123526 missense probably damaging 1.00
R4575:Nol6 UTSW 4 41120299 missense probably benign 0.00
R4637:Nol6 UTSW 4 41121788 missense probably damaging 0.99
R4700:Nol6 UTSW 4 41118944 missense possibly damaging 0.58
R4820:Nol6 UTSW 4 41121508 missense probably damaging 1.00
R4975:Nol6 UTSW 4 41120167 missense probably benign 0.00
R5395:Nol6 UTSW 4 41118392 intron probably benign
R5826:Nol6 UTSW 4 41122158 missense probably benign 0.04
R6531:Nol6 UTSW 4 41118154 missense probably benign 0.02
R6943:Nol6 UTSW 4 41118962 missense probably damaging 1.00
R7001:Nol6 UTSW 4 41121279 missense probably benign 0.00
R7035:Nol6 UTSW 4 41118479 missense probably benign 0.01
R7282:Nol6 UTSW 4 41119468 missense probably benign 0.18
R7327:Nol6 UTSW 4 41116686 missense probably benign 0.34
R7402:Nol6 UTSW 4 41118699 missense probably damaging 1.00
R7483:Nol6 UTSW 4 41117424 missense possibly damaging 0.92
R7505:Nol6 UTSW 4 41120352 missense probably damaging 1.00
R7669:Nol6 UTSW 4 41118717 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCTTCCAGAGGACACCAATC -3'
(R):5'- TGGATGCCTGGGAATGAGTAC -3'

Sequencing Primer
(F):5'- AATCACCTCTCCACCATGCTGG -3'
(R):5'- AAAGGCTTCCGTAGACCGTGTTC -3'
Posted On2015-07-21