Incidental Mutation 'R4458:Uspl1'
ID330001
Institutional Source Beutler Lab
Gene Symbol Uspl1
Ensembl Gene ENSMUSG00000041264
Gene Nameubiquitin specific peptidase like 1
SynonymsE430026A01Rik
MMRRC Submission 041718-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R4458 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location149184350-149215434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 149214152 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 707 (S707T)
Ref Sequence ENSEMBL: ENSMUSP00000114104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050472] [ENSMUST00000100410] [ENSMUST00000117878] [ENSMUST00000119685] [ENSMUST00000121416] [ENSMUST00000122160] [ENSMUST00000126168]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050472
AA Change: S721T

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050172
Gene: ENSMUSG00000041264
AA Change: S721T

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 213 486 7e-139 PFAM
Pfam:DUF4650 557 1087 1.9e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100410
SMART Domains Protein: ENSMUSP00000097978
Gene: ENSMUSG00000041264

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 213 486 1.4e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117878
SMART Domains Protein: ENSMUSP00000113176
Gene: ENSMUSG00000041264

DomainStartEndE-ValueType
Pfam:Peptidase_C98 14 287 5.6e-140 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119685
AA Change: S707T

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114104
Gene: ENSMUSG00000041264
AA Change: S707T

DomainStartEndE-ValueType
low complexity region 160 178 N/A INTRINSIC
Pfam:Peptidase_C98 199 472 6.9e-139 PFAM
Pfam:DUF4650 543 1073 1.8e-213 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121416
AA Change: S522T

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113894
Gene: ENSMUSG00000041264
AA Change: S522T

DomainStartEndE-ValueType
Pfam:Peptidase_C98 14 287 8.5e-139 PFAM
Pfam:DUF4650 358 888 1.5e-213 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122160
AA Change: S721T

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113247
Gene: ENSMUSG00000041264
AA Change: S721T

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 214 486 2.5e-125 PFAM
Pfam:DUF4650 558 1087 1e-205 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150921
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik G A 3: 107,232,681 probably null Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Ankrd44 A T 1: 54,762,391 I56N possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Arhgap5 T A 12: 52,517,957 N570K probably benign Het
Arid1b A T 17: 5,242,916 Q703L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cad T A 5: 31,061,226 V499D probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr2 A C 3: 108,394,997 I2605S probably damaging Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Clec18a T A 8: 111,075,470 T296S probably damaging Het
Crybg2 C T 4: 134,074,894 P1122S probably benign Het
Cyld G T 8: 88,719,301 S309I probably benign Het
Dctn5 G T 7: 122,135,080 R49L probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Erbin C A 13: 103,833,557 V1184F probably damaging Het
Ercc2 G T 7: 19,393,846 R406L probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam46a T C 9: 85,326,474 I99V possibly damaging Het
Flad1 T C 3: 89,408,934 H107R probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gabbr1 G T 17: 37,067,775 probably null Het
Haghl A T 17: 25,785,020 V30E probably damaging Het
Itga5 C T 15: 103,350,203 E822K probably damaging Het
Klhl26 T A 8: 70,452,692 E108D possibly damaging Het
Kpnb1 A T 11: 97,169,170 L558Q probably damaging Het
Lias T C 5: 65,394,040 probably null Het
Ltbp1 A T 17: 75,276,507 K434M possibly damaging Het
March1 C A 8: 66,456,171 A177E probably damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nol4 T C 18: 22,751,995 I419V probably damaging Het
Nol6 A G 4: 41,115,888 L1068P probably damaging Het
Nrcam T C 12: 44,559,730 S420P probably damaging Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pitpnm2 T C 5: 124,121,376 T1299A probably benign Het
Prdm16 A G 4: 154,322,308 V1220A probably benign Het
Saraf T C 8: 34,154,716 S25P unknown Het
Serpine3 C A 14: 62,674,473 L295I probably damaging Het
Sntb2 G A 8: 106,991,607 probably null Het
Surf6 T C 2: 26,892,709 E202G probably benign Het
Th A T 7: 142,896,953 D135E probably benign Het
Traf1 A G 2: 34,945,433 Y326H probably damaging Het
Tshz2 G A 2: 169,885,088 A66T probably benign Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Ubqlnl A G 7: 104,149,189 V367A probably benign Het
Utp18 A G 11: 93,870,533 S350P possibly damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn1r229 A G 17: 20,814,632 I46M probably damaging Het
Vnn3 T C 10: 23,865,669 Y291H probably benign Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Wrn T A 8: 33,294,998 T692S probably damaging Het
Yeats2 T C 16: 20,213,321 I19T probably damaging Het
Zfp13 G A 17: 23,581,176 A36V probably benign Het
Other mutations in Uspl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Uspl1 APN 5 149215214 missense possibly damaging 0.95
IGL00571:Uspl1 APN 5 149188360 missense probably damaging 0.99
IGL01134:Uspl1 APN 5 149204293 missense probably damaging 1.00
IGL02222:Uspl1 APN 5 149194044 missense probably benign 0.25
IGL02383:Uspl1 APN 5 149213402 missense probably damaging 0.98
IGL02538:Uspl1 APN 5 149188459 missense probably damaging 1.00
IGL02546:Uspl1 APN 5 149204304 missense possibly damaging 0.95
IGL02585:Uspl1 APN 5 149214062 nonsense probably null
IGL02971:Uspl1 APN 5 149188346 missense possibly damaging 0.84
R0020:Uspl1 UTSW 5 149209779 missense probably damaging 1.00
R0070:Uspl1 UTSW 5 149209705 missense probably damaging 1.00
R0142:Uspl1 UTSW 5 149188349 missense possibly damaging 0.68
R0433:Uspl1 UTSW 5 149214815 missense probably damaging 1.00
R0554:Uspl1 UTSW 5 149187834 missense probably damaging 1.00
R0612:Uspl1 UTSW 5 149214957 missense probably damaging 1.00
R1195:Uspl1 UTSW 5 149194321 missense probably benign 0.24
R1195:Uspl1 UTSW 5 149194321 missense probably benign 0.24
R1195:Uspl1 UTSW 5 149194321 missense probably benign 0.24
R1465:Uspl1 UTSW 5 149214032 missense probably benign 0.12
R1465:Uspl1 UTSW 5 149214032 missense probably benign 0.12
R1623:Uspl1 UTSW 5 149215199 missense probably damaging 1.00
R1737:Uspl1 UTSW 5 149201858 missense probably damaging 1.00
R1793:Uspl1 UTSW 5 149213436 missense probably damaging 1.00
R1823:Uspl1 UTSW 5 149214414 missense probably benign 0.25
R2088:Uspl1 UTSW 5 149209750 missense probably damaging 1.00
R2099:Uspl1 UTSW 5 149214758 missense probably damaging 1.00
R2497:Uspl1 UTSW 5 149187854 missense probably damaging 0.98
R2944:Uspl1 UTSW 5 149201796 missense probably damaging 1.00
R3437:Uspl1 UTSW 5 149214697 utr 3 prime probably benign
R4132:Uspl1 UTSW 5 149204349 missense probably damaging 0.99
R4537:Uspl1 UTSW 5 149187778 missense possibly damaging 0.66
R4623:Uspl1 UTSW 5 149214595 missense probably damaging 0.99
R4633:Uspl1 UTSW 5 149214392 missense probably damaging 1.00
R4737:Uspl1 UTSW 5 149194339 missense possibly damaging 0.86
R4743:Uspl1 UTSW 5 149209756 missense probably damaging 1.00
R5200:Uspl1 UTSW 5 149214113 missense probably benign 0.02
R5222:Uspl1 UTSW 5 149214101 missense possibly damaging 0.77
R5337:Uspl1 UTSW 5 149214746 missense probably damaging 0.99
R5496:Uspl1 UTSW 5 149209779 missense probably damaging 1.00
R5654:Uspl1 UTSW 5 149209711 missense probably damaging 1.00
R5845:Uspl1 UTSW 5 149193960 missense probably benign 0.01
R6266:Uspl1 UTSW 5 149204366 missense probably damaging 1.00
R6331:Uspl1 UTSW 5 149214287 missense probably benign 0.40
R6338:Uspl1 UTSW 5 149215034 missense probably benign 0.03
R6774:Uspl1 UTSW 5 149214094 missense probably benign 0.00
R6855:Uspl1 UTSW 5 149187845 missense probably damaging 1.00
R7131:Uspl1 UTSW 5 149193935 missense probably benign 0.00
R7152:Uspl1 UTSW 5 149187778 missense possibly damaging 0.66
R7446:Uspl1 UTSW 5 149204272 nonsense probably null
X0019:Uspl1 UTSW 5 149214267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACCCTGTGACTGATGCCC -3'
(R):5'- ACATTCTTTTAGACCTGCGGC -3'

Sequencing Primer
(F):5'- GTGACTGATGCCCCTGTTC -3'
(R):5'- ACTGGCTCCTTTAACAGAAGG -3'
Posted On2015-07-21