Incidental Mutation 'R4458:Ercc2'
ID330003
Institutional Source Beutler Lab
Gene Symbol Ercc2
Ensembl Gene ENSMUSG00000030400
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 2
SynonymsXPD, Ercc-2
MMRRC Submission 041718-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4458 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19382010-19395694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19393846 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 406 (R406L)
Ref Sequence ENSEMBL: ENSMUSP00000104101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047170] [ENSMUST00000062831] [ENSMUST00000108457] [ENSMUST00000108458] [ENSMUST00000108459] [ENSMUST00000108460] [ENSMUST00000108461]
Predicted Effect probably benign
Transcript: ENSMUST00000047170
SMART Domains Protein: ENSMUSP00000038091
Gene: ENSMUSG00000040714

DomainStartEndE-ValueType
Pfam:Rab5-bind 79 248 1.1e-56 PFAM
Pfam:TPR_10 206 247 1.7e-6 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000062831
AA Change: R658L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054380
Gene: ENSMUSG00000030400
AA Change: R658L

DomainStartEndE-ValueType
DEXDc 8 280 1.62e-144 SMART
Blast:DEXDc2 340 369 3e-10 BLAST
Blast:DEXDc 412 467 9e-27 BLAST
HELICc 542 686 1.32e-76 SMART
low complexity region 733 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108457
SMART Domains Protein: ENSMUSP00000104097
Gene: ENSMUSG00000040714

DomainStartEndE-ValueType
Pfam:Rab5-bind 79 248 1.7e-57 PFAM
Pfam:TPR_10 206 247 3.2e-6 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108458
SMART Domains Protein: ENSMUSP00000104098
Gene: ENSMUSG00000040714

DomainStartEndE-ValueType
Pfam:Rab5-bind 79 248 1.1e-56 PFAM
Pfam:TPR_10 206 247 1.7e-6 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108459
SMART Domains Protein: ENSMUSP00000104099
Gene: ENSMUSG00000040714

DomainStartEndE-ValueType
coiled coil region 88 150 N/A INTRINSIC
low complexity region 157 173 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
Pfam:TPR_10 206 247 5.6e-7 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108460
AA Change: R637L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104100
Gene: ENSMUSG00000030400
AA Change: R637L

DomainStartEndE-ValueType
DEXDc 8 259 1.7e-120 SMART
Blast:DEXDc2 319 348 3e-10 BLAST
Blast:DEXDc 391 446 8e-27 BLAST
HELICc 521 665 1.32e-76 SMART
low complexity region 712 730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108461
AA Change: R406L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104101
Gene: ENSMUSG00000030400
AA Change: R406L

DomainStartEndE-ValueType
Pfam:DUF1227 16 161 4.5e-60 PFAM
Blast:HELICc2 193 262 1e-40 BLAST
HELICc 290 434 1.32e-76 SMART
low complexity region 481 499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128167
Predicted Effect unknown
Transcript: ENSMUST00000129249
AA Change: R581L
SMART Domains Protein: ENSMUSP00000117840
Gene: ENSMUSG00000030400
AA Change: R581L

DomainStartEndE-ValueType
DEXDc 10 204 1.14e-71 SMART
Blast:DEXDc2 264 293 2e-10 BLAST
Blast:DEXDc 336 391 5e-27 BLAST
HELICc 466 610 1.32e-76 SMART
low complexity region 657 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180691
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nucleotide excision repair pathway is a mechanism to repair damage to DNA. The protein encoded by this gene is involved in transcription-coupled nucleotide excision repair and is an integral member of the basal transcription factor BTF2/TFIIH complex. The gene product has ATP-dependent DNA helicase activity and belongs to the RAD3/XPD subfamily of helicases. Defects in this gene can result in three different disorders, the cancer-prone syndrome xeroderma pigmentosum complementation group D, trichothiodystrophy, and Cockayne syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die prior to implantation. Homozygotes for a targeted missense mutation exhibit brittle and greying hair, cachexia, infertility, osteosclerosis, osteoporosis, reduced lifespan, UV sensitivity, and skin defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik G A 3: 107,232,681 probably null Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Ankrd44 A T 1: 54,762,391 I56N possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Arhgap5 T A 12: 52,517,957 N570K probably benign Het
Arid1b A T 17: 5,242,916 Q703L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cad T A 5: 31,061,226 V499D probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr2 A C 3: 108,394,997 I2605S probably damaging Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Clec18a T A 8: 111,075,470 T296S probably damaging Het
Crybg2 C T 4: 134,074,894 P1122S probably benign Het
Cyld G T 8: 88,719,301 S309I probably benign Het
Dctn5 G T 7: 122,135,080 R49L probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Erbin C A 13: 103,833,557 V1184F probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam46a T C 9: 85,326,474 I99V possibly damaging Het
Flad1 T C 3: 89,408,934 H107R probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gabbr1 G T 17: 37,067,775 probably null Het
Haghl A T 17: 25,785,020 V30E probably damaging Het
Itga5 C T 15: 103,350,203 E822K probably damaging Het
Klhl26 T A 8: 70,452,692 E108D possibly damaging Het
Kpnb1 A T 11: 97,169,170 L558Q probably damaging Het
Lias T C 5: 65,394,040 probably null Het
Ltbp1 A T 17: 75,276,507 K434M possibly damaging Het
March1 C A 8: 66,456,171 A177E probably damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nol4 T C 18: 22,751,995 I419V probably damaging Het
Nol6 A G 4: 41,115,888 L1068P probably damaging Het
Nrcam T C 12: 44,559,730 S420P probably damaging Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pitpnm2 T C 5: 124,121,376 T1299A probably benign Het
Prdm16 A G 4: 154,322,308 V1220A probably benign Het
Saraf T C 8: 34,154,716 S25P unknown Het
Serpine3 C A 14: 62,674,473 L295I probably damaging Het
Sntb2 G A 8: 106,991,607 probably null Het
Surf6 T C 2: 26,892,709 E202G probably benign Het
Th A T 7: 142,896,953 D135E probably benign Het
Traf1 A G 2: 34,945,433 Y326H probably damaging Het
Tshz2 G A 2: 169,885,088 A66T probably benign Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Ubqlnl A G 7: 104,149,189 V367A probably benign Het
Uspl1 T A 5: 149,214,152 S707T possibly damaging Het
Utp18 A G 11: 93,870,533 S350P possibly damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn1r229 A G 17: 20,814,632 I46M probably damaging Het
Vnn3 T C 10: 23,865,669 Y291H probably benign Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Wrn T A 8: 33,294,998 T692S probably damaging Het
Yeats2 T C 16: 20,213,321 I19T probably damaging Het
Zfp13 G A 17: 23,581,176 A36V probably benign Het
Other mutations in Ercc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Ercc2 APN 7 19390417 missense probably benign 0.03
IGL01767:Ercc2 APN 7 19390421 missense probably damaging 1.00
IGL01810:Ercc2 APN 7 19393449 missense probably damaging 1.00
IGL02485:Ercc2 APN 7 19394045 missense possibly damaging 0.83
IGL02891:Ercc2 APN 7 19393286 missense probably damaging 1.00
IGL03010:Ercc2 APN 7 19391566 missense possibly damaging 0.89
R0304:Ercc2 UTSW 7 19386708 missense possibly damaging 0.75
R0512:Ercc2 UTSW 7 19393887 missense probably damaging 0.99
R1467:Ercc2 UTSW 7 19385886 missense probably benign 0.05
R1467:Ercc2 UTSW 7 19385886 missense probably benign 0.05
R1600:Ercc2 UTSW 7 19385941 missense probably benign 0.00
R1636:Ercc2 UTSW 7 19387124 missense possibly damaging 0.94
R2156:Ercc2 UTSW 7 19386792 missense possibly damaging 0.95
R2446:Ercc2 UTSW 7 19386944 missense probably damaging 0.97
R4869:Ercc2 UTSW 7 19386807 missense probably damaging 1.00
R5861:Ercc2 UTSW 7 19394141 missense possibly damaging 0.91
R6960:Ercc2 UTSW 7 19393690 missense probably damaging 0.98
R7301:Ercc2 UTSW 7 19394135 missense probably benign 0.09
R7354:Ercc2 UTSW 7 19393654 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCATGCACTGTAATCCTGCTC -3'
(R):5'- ACATTAGAGCCCAGGTTGGAG -3'

Sequencing Primer
(F):5'- GGAGTTCCCTATGTCTATACCCAGAG -3'
(R):5'- CAGGTTGGAGCCCAGGC -3'
Posted On2015-07-21