Incidental Mutation 'R4458:Cdkn2d'
ID330018
Institutional Source Beutler Lab
Gene Symbol Cdkn2d
Ensembl Gene ENSMUSG00000096472
Gene Namecyclin dependent kinase inhibitor 2D
Synonymsp19, p19INK4d, INK4d, INK4d
MMRRC Submission 041718-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R4458 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21288410-21291407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 21290889 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 21 (V21L)
Ref Sequence ENSEMBL: ENSMUSP00000150701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003397] [ENSMUST00000038671] [ENSMUST00000086374] [ENSMUST00000115433] [ENSMUST00000184326] [ENSMUST00000213407] [ENSMUST00000213762] [ENSMUST00000215619]
Predicted Effect probably benign
Transcript: ENSMUST00000003397
SMART Domains Protein: ENSMUSP00000003397
Gene: ENSMUSG00000003309

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.3e-9 PFAM
Pfam:Adap_comp_sub 157 422 7.3e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038671
SMART Domains Protein: ENSMUSP00000039688
Gene: ENSMUSG00000035047

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
Pfam:Kri1 346 439 3.2e-27 PFAM
Pfam:Kri1_C 507 595 8.4e-37 PFAM
low complexity region 653 666 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000086374
AA Change: V21L
SMART Domains Protein: ENSMUSP00000083561
Gene: ENSMUSG00000096472
AA Change: V21L

DomainStartEndE-ValueType
ANK 41 69 1.01e2 SMART
ANK 73 102 1.73e-4 SMART
ANK 106 134 8.89e1 SMART
Blast:ANK 138 166 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000115433
SMART Domains Protein: ENSMUSP00000111093
Gene: ENSMUSG00000003309

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.4e-9 PFAM
Pfam:Adap_comp_sub 157 424 4.7e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183912
Predicted Effect probably benign
Transcript: ENSMUST00000184326
SMART Domains Protein: ENSMUSP00000139184
Gene: ENSMUSG00000035047

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
Pfam:Kri1 207 317 4.4e-27 PFAM
Pfam:Kri1_C 381 472 3.6e-36 PFAM
low complexity region 529 542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184615
Predicted Effect probably benign
Transcript: ENSMUST00000213407
AA Change: V21L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213762
Predicted Effect probably benign
Transcript: ENSMUST00000215619
AA Change: V21L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase inhibitors. This protein has been shown to form a stable complex with CDK4 or CDK6, and prevent the activation of the CDK kinases, thus function as a cell growth regulator that controls cell cycle G1 progression. The abundance of the transcript of this gene was found to oscillate in a cell-cycle dependent manner with the lowest expression at mid G1 and a maximal expression during S phase. The negative regulation of the cell cycle involved in this protein was shown to participate in repressing neuronal proliferation, as well as spermatogenesis. Two alternatively spliced variants of this gene, which encode an identical protein, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both female and male homozygous null mice are fertile in spite of testicular atrophy and increased male germ cell apoptosis due to delayed meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik G A 3: 107,232,681 probably null Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Ankrd44 A T 1: 54,762,391 I56N possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Arhgap5 T A 12: 52,517,957 N570K probably benign Het
Arid1b A T 17: 5,242,916 Q703L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cad T A 5: 31,061,226 V499D probably damaging Het
Celsr2 A C 3: 108,394,997 I2605S probably damaging Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Clec18a T A 8: 111,075,470 T296S probably damaging Het
Crybg2 C T 4: 134,074,894 P1122S probably benign Het
Cyld G T 8: 88,719,301 S309I probably benign Het
Dctn5 G T 7: 122,135,080 R49L probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Erbin C A 13: 103,833,557 V1184F probably damaging Het
Ercc2 G T 7: 19,393,846 R406L probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam46a T C 9: 85,326,474 I99V possibly damaging Het
Flad1 T C 3: 89,408,934 H107R probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gabbr1 G T 17: 37,067,775 probably null Het
Haghl A T 17: 25,785,020 V30E probably damaging Het
Itga5 C T 15: 103,350,203 E822K probably damaging Het
Klhl26 T A 8: 70,452,692 E108D possibly damaging Het
Kpnb1 A T 11: 97,169,170 L558Q probably damaging Het
Lias T C 5: 65,394,040 probably null Het
Ltbp1 A T 17: 75,276,507 K434M possibly damaging Het
March1 C A 8: 66,456,171 A177E probably damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nol4 T C 18: 22,751,995 I419V probably damaging Het
Nol6 A G 4: 41,115,888 L1068P probably damaging Het
Nrcam T C 12: 44,559,730 S420P probably damaging Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pitpnm2 T C 5: 124,121,376 T1299A probably benign Het
Prdm16 A G 4: 154,322,308 V1220A probably benign Het
Saraf T C 8: 34,154,716 S25P unknown Het
Serpine3 C A 14: 62,674,473 L295I probably damaging Het
Sntb2 G A 8: 106,991,607 probably null Het
Surf6 T C 2: 26,892,709 E202G probably benign Het
Th A T 7: 142,896,953 D135E probably benign Het
Traf1 A G 2: 34,945,433 Y326H probably damaging Het
Tshz2 G A 2: 169,885,088 A66T probably benign Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Ubqlnl A G 7: 104,149,189 V367A probably benign Het
Uspl1 T A 5: 149,214,152 S707T possibly damaging Het
Utp18 A G 11: 93,870,533 S350P possibly damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn1r229 A G 17: 20,814,632 I46M probably damaging Het
Vnn3 T C 10: 23,865,669 Y291H probably benign Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Wrn T A 8: 33,294,998 T692S probably damaging Het
Yeats2 T C 16: 20,213,321 I19T probably damaging Het
Zfp13 G A 17: 23,581,176 A36V probably benign Het
Other mutations in Cdkn2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02516:Cdkn2d APN 9 21289143 missense probably benign 0.04
R0238:Cdkn2d UTSW 9 21290992 start gained probably benign
R0238:Cdkn2d UTSW 9 21290992 start gained probably benign
R2064:Cdkn2d UTSW 9 21290879 missense probably damaging 1.00
R4454:Cdkn2d UTSW 9 21290889 missense probably benign
R4455:Cdkn2d UTSW 9 21290889 missense probably benign
R4456:Cdkn2d UTSW 9 21290889 missense probably benign
R4457:Cdkn2d UTSW 9 21290889 missense probably benign
R4462:Cdkn2d UTSW 9 21290889 missense probably benign
R4463:Cdkn2d UTSW 9 21290889 missense probably benign
R4735:Cdkn2d UTSW 9 21290889 missense probably benign
R4854:Cdkn2d UTSW 9 21290927 missense probably benign
R5493:Cdkn2d UTSW 9 21289007 missense probably benign 0.00
R7560:Cdkn2d UTSW 9 21289244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGACAAGAGCTGAAAAGCCATC -3'
(R):5'- TCATAGAGTTGGCCCTGGTG -3'

Sequencing Primer
(F):5'- GAGCTGAAAAGCCATCCCCTC -3'
(R):5'- TGGCACCGCAGTCCCTAG -3'
Posted On2015-07-21