Incidental Mutation 'R4458:Kpnb1'
ID330025
Institutional Source Beutler Lab
Gene Symbol Kpnb1
Ensembl Gene ENSMUSG00000001440
Gene Namekaryopherin (importin) beta 1
SynonymsImpnb
MMRRC Submission 041718-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4458 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location97159714-97187881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97169170 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 558 (L558Q)
Ref Sequence ENSEMBL: ENSMUSP00000001479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001479]
PDB Structure
N-TERMINAL FRAGMENT OF IMPORTIN-BETA [X-RAY DIFFRACTION]
Crystal structure of Importin-beta and SREBP-2 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000001479
AA Change: L558Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001479
Gene: ENSMUSG00000001440
AA Change: L558Q

DomainStartEndE-ValueType
IBN_N 21 101 3.72e-5 SMART
Blast:ARM 158 203 4e-7 BLAST
Pfam:HEAT_EZ 380 435 3e-13 PFAM
Pfam:HEAT 409 439 2.6e-7 PFAM
Blast:ARM 440 477 7e-17 BLAST
low complexity region 478 495 N/A INTRINSIC
Blast:IBN_N 528 590 9e-25 BLAST
Blast:ARM 594 637 1e-18 BLAST
Blast:ARM 784 827 1e-5 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153727
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik G A 3: 107,232,681 probably null Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Ankrd44 A T 1: 54,762,391 I56N possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Arhgap5 T A 12: 52,517,957 N570K probably benign Het
Arid1b A T 17: 5,242,916 Q703L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cad T A 5: 31,061,226 V499D probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr2 A C 3: 108,394,997 I2605S probably damaging Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Clec18a T A 8: 111,075,470 T296S probably damaging Het
Crybg2 C T 4: 134,074,894 P1122S probably benign Het
Cyld G T 8: 88,719,301 S309I probably benign Het
Dctn5 G T 7: 122,135,080 R49L probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Erbin C A 13: 103,833,557 V1184F probably damaging Het
Ercc2 G T 7: 19,393,846 R406L probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam46a T C 9: 85,326,474 I99V possibly damaging Het
Flad1 T C 3: 89,408,934 H107R probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gabbr1 G T 17: 37,067,775 probably null Het
Haghl A T 17: 25,785,020 V30E probably damaging Het
Itga5 C T 15: 103,350,203 E822K probably damaging Het
Klhl26 T A 8: 70,452,692 E108D possibly damaging Het
Lias T C 5: 65,394,040 probably null Het
Ltbp1 A T 17: 75,276,507 K434M possibly damaging Het
March1 C A 8: 66,456,171 A177E probably damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nol4 T C 18: 22,751,995 I419V probably damaging Het
Nol6 A G 4: 41,115,888 L1068P probably damaging Het
Nrcam T C 12: 44,559,730 S420P probably damaging Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pitpnm2 T C 5: 124,121,376 T1299A probably benign Het
Prdm16 A G 4: 154,322,308 V1220A probably benign Het
Saraf T C 8: 34,154,716 S25P unknown Het
Serpine3 C A 14: 62,674,473 L295I probably damaging Het
Sntb2 G A 8: 106,991,607 probably null Het
Surf6 T C 2: 26,892,709 E202G probably benign Het
Th A T 7: 142,896,953 D135E probably benign Het
Traf1 A G 2: 34,945,433 Y326H probably damaging Het
Tshz2 G A 2: 169,885,088 A66T probably benign Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Ubqlnl A G 7: 104,149,189 V367A probably benign Het
Uspl1 T A 5: 149,214,152 S707T possibly damaging Het
Utp18 A G 11: 93,870,533 S350P possibly damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn1r229 A G 17: 20,814,632 I46M probably damaging Het
Vnn3 T C 10: 23,865,669 Y291H probably benign Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Wrn T A 8: 33,294,998 T692S probably damaging Het
Yeats2 T C 16: 20,213,321 I19T probably damaging Het
Zfp13 G A 17: 23,581,176 A36V probably benign Het
Other mutations in Kpnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Kpnb1 APN 11 97166102 missense probably damaging 1.00
IGL01919:Kpnb1 APN 11 97164730 missense probably benign
IGL02161:Kpnb1 APN 11 97168936 missense probably benign 0.01
IGL02679:Kpnb1 APN 11 97177260 missense possibly damaging 0.92
IGL02866:Kpnb1 APN 11 97177286 missense probably damaging 0.99
IGL02899:Kpnb1 APN 11 97175786 missense probably damaging 1.00
R0373:Kpnb1 UTSW 11 97185090 missense probably damaging 1.00
R0542:Kpnb1 UTSW 11 97187572 missense probably benign 0.12
R0724:Kpnb1 UTSW 11 97178304 missense probably damaging 1.00
R0825:Kpnb1 UTSW 11 97171675 missense probably damaging 0.98
R0853:Kpnb1 UTSW 11 97187411 missense probably damaging 0.97
R1481:Kpnb1 UTSW 11 97178310 missense probably damaging 1.00
R3802:Kpnb1 UTSW 11 97166129 missense possibly damaging 0.92
R4490:Kpnb1 UTSW 11 97171598 missense probably benign
R4757:Kpnb1 UTSW 11 97177334 missense possibly damaging 0.65
R5500:Kpnb1 UTSW 11 97173111 missense possibly damaging 0.94
R6360:Kpnb1 UTSW 11 97173270 missense probably benign
R6494:Kpnb1 UTSW 11 97181648 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTGCAATGTAACAGGGAGC -3'
(R):5'- ATGTCTCTGAACTGCATCCC -3'

Sequencing Primer
(F):5'- CAGCACGCTGAGAGCTTTTTG -3'
(R):5'- TGAACTGCATCCCCAACCTCTG -3'
Posted On2015-07-21