Incidental Mutation 'R4458:Vmn1r229'
ID330036
Institutional Source Beutler Lab
Gene Symbol Vmn1r229
Ensembl Gene ENSMUSG00000061150
Gene Namevomeronasal 1 receptor 229
SynonymsV1re1
MMRRC Submission 041718-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4458 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20814495-20815415 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20814632 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 46 (I46M)
Ref Sequence ENSEMBL: ENSMUSP00000076045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076759]
Predicted Effect probably damaging
Transcript: ENSMUST00000076759
AA Change: I46M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076045
Gene: ENSMUSG00000061150
AA Change: I46M

DomainStartEndE-ValueType
Pfam:TAS2R 3 286 2.7e-13 PFAM
Pfam:7tm_1 22 285 4.3e-10 PFAM
Pfam:V1R 31 293 6.6e-29 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik G A 3: 107,232,681 probably null Het
Akap13 A G 7: 75,739,465 D2377G probably damaging Het
Ankrd44 A T 1: 54,762,391 I56N possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Arhgap5 T A 12: 52,517,957 N570K probably benign Het
Arid1b A T 17: 5,242,916 Q703L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cad T A 5: 31,061,226 V499D probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr2 A C 3: 108,394,997 I2605S probably damaging Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Clec18a T A 8: 111,075,470 T296S probably damaging Het
Crybg2 C T 4: 134,074,894 P1122S probably benign Het
Cyld G T 8: 88,719,301 S309I probably benign Het
Dctn5 G T 7: 122,135,080 R49L probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Erbin C A 13: 103,833,557 V1184F probably damaging Het
Ercc2 G T 7: 19,393,846 R406L probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam46a T C 9: 85,326,474 I99V possibly damaging Het
Flad1 T C 3: 89,408,934 H107R probably benign Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gabbr1 G T 17: 37,067,775 probably null Het
Haghl A T 17: 25,785,020 V30E probably damaging Het
Itga5 C T 15: 103,350,203 E822K probably damaging Het
Klhl26 T A 8: 70,452,692 E108D possibly damaging Het
Kpnb1 A T 11: 97,169,170 L558Q probably damaging Het
Lias T C 5: 65,394,040 probably null Het
Ltbp1 A T 17: 75,276,507 K434M possibly damaging Het
March1 C A 8: 66,456,171 A177E probably damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nol4 T C 18: 22,751,995 I419V probably damaging Het
Nol6 A G 4: 41,115,888 L1068P probably damaging Het
Nrcam T C 12: 44,559,730 S420P probably damaging Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pitpnm2 T C 5: 124,121,376 T1299A probably benign Het
Prdm16 A G 4: 154,322,308 V1220A probably benign Het
Saraf T C 8: 34,154,716 S25P unknown Het
Serpine3 C A 14: 62,674,473 L295I probably damaging Het
Sntb2 G A 8: 106,991,607 probably null Het
Surf6 T C 2: 26,892,709 E202G probably benign Het
Th A T 7: 142,896,953 D135E probably benign Het
Traf1 A G 2: 34,945,433 Y326H probably damaging Het
Tshz2 G A 2: 169,885,088 A66T probably benign Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Ubqlnl A G 7: 104,149,189 V367A probably benign Het
Uspl1 T A 5: 149,214,152 S707T possibly damaging Het
Utp18 A G 11: 93,870,533 S350P possibly damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vnn3 T C 10: 23,865,669 Y291H probably benign Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Wrn T A 8: 33,294,998 T692S probably damaging Het
Yeats2 T C 16: 20,213,321 I19T probably damaging Het
Zfp13 G A 17: 23,581,176 A36V probably benign Het
Other mutations in Vmn1r229
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0682:Vmn1r229 UTSW 17 20814688 missense probably benign 0.43
R1401:Vmn1r229 UTSW 17 20814642 missense possibly damaging 0.63
R1484:Vmn1r229 UTSW 17 20814529 missense probably damaging 1.00
R1551:Vmn1r229 UTSW 17 20814789 missense probably benign 0.36
R1568:Vmn1r229 UTSW 17 20814805 missense probably damaging 1.00
R1793:Vmn1r229 UTSW 17 20814712 missense possibly damaging 0.61
R2157:Vmn1r229 UTSW 17 20815376 missense possibly damaging 0.82
R4556:Vmn1r229 UTSW 17 20814691 missense possibly damaging 0.79
R4891:Vmn1r229 UTSW 17 20814819 missense probably damaging 1.00
R6310:Vmn1r229 UTSW 17 20814714 missense probably benign 0.01
R6995:Vmn1r229 UTSW 17 20815015 missense probably damaging 1.00
Z1088:Vmn1r229 UTSW 17 20815065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCAATACATGATTTGGCTCAG -3'
(R):5'- ATGGTGATTGCCTGAAAGACAC -3'

Sequencing Primer
(F):5'- GCTCAGAGATGTGATTATTGCC -3'
(R):5'- CTCAAGAGACAGGTCATGCTAATTG -3'
Posted On2015-07-21