Incidental Mutation 'R4459:Gc'
ID330053
Institutional Source Beutler Lab
Gene Symbol Gc
Ensembl Gene ENSMUSG00000035540
Gene Namevitamin D binding protein
SynonymsDBP, vitamin D binding protein
MMRRC Submission 041579-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4459 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location89417522-89457898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89441287 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 206 (M206V)
Ref Sequence ENSEMBL: ENSMUSP00000046636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049209]
Predicted Effect probably benign
Transcript: ENSMUST00000049209
AA Change: M206V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046636
Gene: ENSMUSG00000035540
AA Change: M206V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
ALBUMIN 17 202 6.82e-68 SMART
ALBUMIN 208 388 1.51e-51 SMART
Pfam:VitD-bind_III 405 469 7.2e-36 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the albumin gene family. It is a multifunctional protein found in plasma, ascitic fluid, cerebrospinal fluid and on the surface of many cell types. It binds to vitamin D and its plasma metabolites and transports them to target tissues. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for disruption of this gene show an essentially normal phenotype. However, they have an increased sensitivity to vitamin D deficiency in the diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,745 L395P probably damaging Het
Abcc4 C T 14: 118,599,393 R652Q probably benign Het
Anks1b G A 10: 90,510,844 V669I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
BC049715 G A 6: 136,840,052 A97T probably damaging Het
Cyp11b1 T A 15: 74,836,359 E422D probably damaging Het
Dmxl1 A T 18: 49,961,216 I2920F possibly damaging Het
Efcab6 C T 15: 83,904,289 G935S probably damaging Het
Esp3 C G 17: 40,633,587 T40S probably null Het
Gm15446 A T 5: 109,943,241 H453L probably benign Het
Hes6 A G 1: 91,412,339 S132P probably damaging Het
Ighg2b T C 12: 113,306,958 Y184C unknown Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kcnj5 A G 9: 32,322,395 I208T probably damaging Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Letm2 A G 8: 25,586,699 C296R probably damaging Het
Lrfn4 C T 19: 4,612,634 V452I probably benign Het
Mypn A G 10: 63,192,432 V284A probably damaging Het
Olfr1110 T C 2: 87,135,661 H220R probably benign Het
Olfr112 G A 17: 37,563,474 T279I probably damaging Het
Olfr1391 A T 11: 49,327,876 N155I probably damaging Het
Olfr898 T A 9: 38,349,992 V297D probably damaging Het
Pcdhgb6 C T 18: 37,742,706 P156S probably benign Het
Pih1d3 A G 1: 31,223,324 D129G probably damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Prl7a2 A G 13: 27,665,996 V31A probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rmnd5a C T 6: 71,396,881 G310R probably damaging Het
Rrm2b T A 15: 37,945,153 probably null Het
Smg8 T C 11: 87,085,570 D395G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tyk2 T C 9: 21,124,415 E157G probably damaging Het
Wdr90 T A 17: 25,861,002 T120S possibly damaging Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Gc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Gc APN 5 89422122 splice site probably benign
IGL02408:Gc APN 5 89445396 missense probably benign
IGL02815:Gc APN 5 89457659 critical splice donor site probably null
R1689:Gc UTSW 5 89441200 critical splice donor site probably null
R2067:Gc UTSW 5 89446517 missense probably damaging 1.00
R2086:Gc UTSW 5 89438342 missense probably damaging 1.00
R4212:Gc UTSW 5 89435575 missense probably benign 0.01
R4930:Gc UTSW 5 89439589 missense probably benign 0.00
R5598:Gc UTSW 5 89438450 critical splice acceptor site probably null
R5768:Gc UTSW 5 89441266 missense probably damaging 1.00
R6194:Gc UTSW 5 89441579 missense probably benign 0.27
R6748:Gc UTSW 5 89435572 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGAGCCCGAGTGCTTGTG -3'
(R):5'- GGAGACTTGGCATTCTGTAATCAAC -3'

Sequencing Primer
(F):5'- GTGGTTCGTTCGTAGACTGCAC -3'
(R):5'- AACATTTCCAAAATTCCTTCACTGC -3'
Posted On2015-07-21