Incidental Mutation 'R4459:Gm15446'
ID330054
Institutional Source Beutler Lab
Gene Symbol Gm15446
Ensembl Gene ENSMUSG00000090015
Gene Namepredicted gene 15446
Synonyms
MMRRC Submission 041579-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4459 (G1)
Quality Score156
Status Not validated
Chromosome5
Chromosomal Location109923400-109943936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109943241 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 453 (H453L)
Ref Sequence ENSEMBL: ENSMUSP00000108163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112544] [ENSMUST00000170826]
Predicted Effect probably benign
Transcript: ENSMUST00000112544
AA Change: H453L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108163
Gene: ENSMUSG00000090015
AA Change: H453L

DomainStartEndE-ValueType
KRAB 4 60 1.74e-14 SMART
ZnF_C2H2 103 125 1.1e-2 SMART
ZnF_C2H2 131 153 1.67e-2 SMART
ZnF_C2H2 159 181 4.87e-4 SMART
ZnF_C2H2 187 209 3.39e-3 SMART
ZnF_C2H2 215 237 1.76e-1 SMART
ZnF_C2H2 243 265 1.3e-4 SMART
ZnF_C2H2 271 293 1.1e-2 SMART
ZnF_C2H2 299 321 2.27e-4 SMART
ZnF_C2H2 327 349 6.99e-5 SMART
ZnF_C2H2 355 377 5.21e-4 SMART
ZnF_C2H2 383 405 9.73e-4 SMART
ZnF_C2H2 411 433 3.39e-3 SMART
ZnF_C2H2 439 461 1.58e-3 SMART
ZnF_C2H2 467 489 5.14e-3 SMART
ZnF_C2H2 495 517 2.61e-4 SMART
ZnF_C2H2 523 545 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146564
Predicted Effect probably benign
Transcript: ENSMUST00000170826
SMART Domains Protein: ENSMUSP00000127438
Gene: ENSMUSG00000090015

DomainStartEndE-ValueType
KRAB 3 59 1.74e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,745 L395P probably damaging Het
Abcc4 C T 14: 118,599,393 R652Q probably benign Het
Anks1b G A 10: 90,510,844 V669I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
BC049715 G A 6: 136,840,052 A97T probably damaging Het
Cyp11b1 T A 15: 74,836,359 E422D probably damaging Het
Dmxl1 A T 18: 49,961,216 I2920F possibly damaging Het
Efcab6 C T 15: 83,904,289 G935S probably damaging Het
Esp3 C G 17: 40,633,587 T40S probably null Het
Gc T C 5: 89,441,287 M206V probably benign Het
Hes6 A G 1: 91,412,339 S132P probably damaging Het
Ighg2b T C 12: 113,306,958 Y184C unknown Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kcnj5 A G 9: 32,322,395 I208T probably damaging Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Letm2 A G 8: 25,586,699 C296R probably damaging Het
Lrfn4 C T 19: 4,612,634 V452I probably benign Het
Mypn A G 10: 63,192,432 V284A probably damaging Het
Olfr1110 T C 2: 87,135,661 H220R probably benign Het
Olfr112 G A 17: 37,563,474 T279I probably damaging Het
Olfr1391 A T 11: 49,327,876 N155I probably damaging Het
Olfr898 T A 9: 38,349,992 V297D probably damaging Het
Pcdhgb6 C T 18: 37,742,706 P156S probably benign Het
Pih1d3 A G 1: 31,223,324 D129G probably damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Prl7a2 A G 13: 27,665,996 V31A probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rmnd5a C T 6: 71,396,881 G310R probably damaging Het
Rrm2b T A 15: 37,945,153 probably null Het
Smg8 T C 11: 87,085,570 D395G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tyk2 T C 9: 21,124,415 E157G probably damaging Het
Wdr90 T A 17: 25,861,002 T120S possibly damaging Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Gm15446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Gm15446 APN 5 109940802 makesense probably null
R0278:Gm15446 UTSW 5 109943415 missense probably benign 0.14
R0606:Gm15446 UTSW 5 109943481 missense probably benign
R1608:Gm15446 UTSW 5 109942457 missense probably damaging 1.00
R1874:Gm15446 UTSW 5 109942553 missense probably damaging 0.99
R1892:Gm15446 UTSW 5 109943387 missense probably damaging 1.00
R2000:Gm15446 UTSW 5 109942811 missense possibly damaging 0.67
R2059:Gm15446 UTSW 5 109942496 missense probably damaging 1.00
R3083:Gm15446 UTSW 5 109943292 missense possibly damaging 0.48
R3883:Gm15446 UTSW 5 109940447 missense probably damaging 0.98
R4086:Gm15446 UTSW 5 109943255 missense probably benign 0.02
R4095:Gm15446 UTSW 5 109940724 intron probably null
R4721:Gm15446 UTSW 5 109943000 missense probably damaging 1.00
R4735:Gm15446 UTSW 5 109942952 missense probably damaging 1.00
R5229:Gm15446 UTSW 5 109943170 missense probably damaging 1.00
R5502:Gm15446 UTSW 5 109940498 nonsense probably null
R6116:Gm15446 UTSW 5 109943036 missense probably damaging 1.00
R6166:Gm15446 UTSW 5 109942780 nonsense probably null
R6322:Gm15446 UTSW 5 109943517 missense probably damaging 1.00
R7871:Gm15446 UTSW 5 109943299 nonsense probably null
R7954:Gm15446 UTSW 5 109943299 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAATGTACTAAATCCTTTGCCTC -3'
(R):5'- ACCACATTGATCACATTTGTAAGG -3'

Sequencing Primer
(F):5'- CATACTGGAGAGAAACCTTATGAATG -3'
(R):5'- GTAAGGTTTCTCTCCCAGTATGAAC -3'
Posted On2015-07-21