Incidental Mutation 'R4459:Letm2'
ID330060
Institutional Source Beutler Lab
Gene Symbol Letm2
Ensembl Gene ENSMUSG00000037363
Gene Nameleucine zipper-EF-hand containing transmembrane protein 2
Synonyms
MMRRC Submission 041579-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R4459 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location25578490-25597582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25586699 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 296 (C296R)
Ref Sequence ENSEMBL: ENSMUSP00000078160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079160] [ENSMUST00000210616] [ENSMUST00000210810] [ENSMUST00000211422]
Predicted Effect probably damaging
Transcript: ENSMUST00000079160
AA Change: C296R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078160
Gene: ENSMUSG00000037363
AA Change: C296R

DomainStartEndE-ValueType
low complexity region 106 117 N/A INTRINSIC
Pfam:LETM1 120 384 1.2e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210321
Predicted Effect probably benign
Transcript: ENSMUST00000210616
Predicted Effect probably benign
Transcript: ENSMUST00000210810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211133
Predicted Effect probably benign
Transcript: ENSMUST00000211422
Meta Mutation Damage Score 0.8912 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,745 L395P probably damaging Het
Abcc4 C T 14: 118,599,393 R652Q probably benign Het
Anks1b G A 10: 90,510,844 V669I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
BC049715 G A 6: 136,840,052 A97T probably damaging Het
Cyp11b1 T A 15: 74,836,359 E422D probably damaging Het
Dmxl1 A T 18: 49,961,216 I2920F possibly damaging Het
Efcab6 C T 15: 83,904,289 G935S probably damaging Het
Esp3 C G 17: 40,633,587 T40S probably null Het
Gc T C 5: 89,441,287 M206V probably benign Het
Gm15446 A T 5: 109,943,241 H453L probably benign Het
Hes6 A G 1: 91,412,339 S132P probably damaging Het
Ighg2b T C 12: 113,306,958 Y184C unknown Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kcnj5 A G 9: 32,322,395 I208T probably damaging Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Lrfn4 C T 19: 4,612,634 V452I probably benign Het
Mypn A G 10: 63,192,432 V284A probably damaging Het
Olfr1110 T C 2: 87,135,661 H220R probably benign Het
Olfr112 G A 17: 37,563,474 T279I probably damaging Het
Olfr1391 A T 11: 49,327,876 N155I probably damaging Het
Olfr898 T A 9: 38,349,992 V297D probably damaging Het
Pcdhgb6 C T 18: 37,742,706 P156S probably benign Het
Pih1d3 A G 1: 31,223,324 D129G probably damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Prl7a2 A G 13: 27,665,996 V31A probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rmnd5a C T 6: 71,396,881 G310R probably damaging Het
Rrm2b T A 15: 37,945,153 probably null Het
Smg8 T C 11: 87,085,570 D395G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tyk2 T C 9: 21,124,415 E157G probably damaging Het
Wdr90 T A 17: 25,861,002 T120S possibly damaging Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Letm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02738:Letm2 APN 8 25586773 missense probably damaging 1.00
selbstlob UTSW 8 25593961 missense probably benign 0.03
IGL03098:Letm2 UTSW 8 25581729 missense possibly damaging 0.73
R0062:Letm2 UTSW 8 25587448 splice site probably benign
R0062:Letm2 UTSW 8 25587448 splice site probably benign
R0207:Letm2 UTSW 8 25578770 missense probably damaging 0.96
R0485:Letm2 UTSW 8 25592558 missense probably damaging 1.00
R1869:Letm2 UTSW 8 25581713 missense probably damaging 0.98
R1870:Letm2 UTSW 8 25596444 splice site probably benign
R1871:Letm2 UTSW 8 25596444 splice site probably benign
R3881:Letm2 UTSW 8 25593868 nonsense probably null
R4115:Letm2 UTSW 8 25580327 nonsense probably null
R4461:Letm2 UTSW 8 25586699 missense probably damaging 1.00
R4961:Letm2 UTSW 8 25594092 missense possibly damaging 0.86
R5063:Letm2 UTSW 8 25581779 missense probably benign 0.26
R5069:Letm2 UTSW 8 25593964 nonsense probably null
R5732:Letm2 UTSW 8 25587325 missense possibly damaging 0.51
R6527:Letm2 UTSW 8 25592506 utr 3 prime probably benign
R6706:Letm2 UTSW 8 25593961 missense probably benign 0.03
R7624:Letm2 UTSW 8 25592537 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCCATTCACTTTGCTGGC -3'
(R):5'- TGGATCCATTTCTATACCACACAG -3'

Sequencing Primer
(F):5'- TGCTGGCTGCCTCTCTGG -3'
(R):5'- AGAAAGTCTCTAATTCCTTCCACATC -3'
Posted On2015-07-21