Incidental Mutation 'R4459:Anks1b'
ID330066
Institutional Source Beutler Lab
Gene Symbol Anks1b
Ensembl Gene ENSMUSG00000058589
Gene Nameankyrin repeat and sterile alpha motif domain containing 1B
SynonymsC030032C09Rik, AIDA-1b, LOC380650, Gm10937, E530015N03Rik
MMRRC Submission 041579-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4459 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location89873509-90973300 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90510844 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 669 (V669I)
Ref Sequence ENSEMBL: ENSMUSP00000096968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099368] [ENSMUST00000182907] [ENSMUST00000182936] [ENSMUST00000183156]
Predicted Effect probably damaging
Transcript: ENSMUST00000099368
AA Change: V669I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096968
Gene: ENSMUSG00000058589
AA Change: V669I

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 931 4.44e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182907
SMART Domains Protein: ENSMUSP00000138614
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182936
SMART Domains Protein: ENSMUSP00000138209
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 5.03e2 SMART
low complexity region 464 479 N/A INTRINSIC
low complexity region 517 543 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183156
AA Change: V669I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138539
Gene: ENSMUSG00000058589
AA Change: V669I

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 948 5.66e-17 SMART
low complexity region 968 983 N/A INTRINSIC
PTB 1056 1194 2.94e-38 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons alters hippocampal synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,745 L395P probably damaging Het
Abcc4 C T 14: 118,599,393 R652Q probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
BC049715 G A 6: 136,840,052 A97T probably damaging Het
Cyp11b1 T A 15: 74,836,359 E422D probably damaging Het
Dmxl1 A T 18: 49,961,216 I2920F possibly damaging Het
Efcab6 C T 15: 83,904,289 G935S probably damaging Het
Esp3 C G 17: 40,633,587 T40S probably null Het
Gc T C 5: 89,441,287 M206V probably benign Het
Gm15446 A T 5: 109,943,241 H453L probably benign Het
Hes6 A G 1: 91,412,339 S132P probably damaging Het
Ighg2b T C 12: 113,306,958 Y184C unknown Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kcnj5 A G 9: 32,322,395 I208T probably damaging Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Letm2 A G 8: 25,586,699 C296R probably damaging Het
Lrfn4 C T 19: 4,612,634 V452I probably benign Het
Mypn A G 10: 63,192,432 V284A probably damaging Het
Olfr1110 T C 2: 87,135,661 H220R probably benign Het
Olfr112 G A 17: 37,563,474 T279I probably damaging Het
Olfr1391 A T 11: 49,327,876 N155I probably damaging Het
Olfr898 T A 9: 38,349,992 V297D probably damaging Het
Pcdhgb6 C T 18: 37,742,706 P156S probably benign Het
Pih1d3 A G 1: 31,223,324 D129G probably damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Prl7a2 A G 13: 27,665,996 V31A probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rmnd5a C T 6: 71,396,881 G310R probably damaging Het
Rrm2b T A 15: 37,945,153 probably null Het
Smg8 T C 11: 87,085,570 D395G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tyk2 T C 9: 21,124,415 E157G probably damaging Het
Wdr90 T A 17: 25,861,002 T120S possibly damaging Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Anks1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Anks1b APN 10 90897238 splice site probably benign
IGL01890:Anks1b APN 10 90644527 missense probably benign 0.15
IGL01966:Anks1b APN 10 90895132 missense probably damaging 1.00
IGL02176:Anks1b APN 10 90042668 missense probably damaging 0.99
IGL02205:Anks1b APN 10 90071094 missense probably benign 0.00
IGL02465:Anks1b APN 10 90163265 nonsense probably null
IGL02534:Anks1b APN 10 90895117 missense probably benign 0.45
IGL02554:Anks1b APN 10 90921378 missense probably damaging 1.00
IGL02820:Anks1b APN 10 90077059 missense possibly damaging 0.93
IGL03164:Anks1b APN 10 90042692 missense probably damaging 1.00
R0096:Anks1b UTSW 10 90074062 missense possibly damaging 0.90
R0482:Anks1b UTSW 10 90359195 missense probably benign 0.00
R0542:Anks1b UTSW 10 90073967 splice site probably benign
R0848:Anks1b UTSW 10 90071125 missense probably damaging 0.99
R1056:Anks1b UTSW 10 90921429 splice site probably null
R1398:Anks1b UTSW 10 90050029 missense probably damaging 1.00
R1446:Anks1b UTSW 10 90511073 missense probably benign 0.00
R1548:Anks1b UTSW 10 90049985 missense possibly damaging 0.79
R1551:Anks1b UTSW 10 90076981 missense probably benign 0.00
R1607:Anks1b UTSW 10 90042548 missense probably damaging 1.00
R1667:Anks1b UTSW 10 90511184 critical splice donor site probably null
R1701:Anks1b UTSW 10 90049954 missense probably damaging 1.00
R1843:Anks1b UTSW 10 90512889 critical splice donor site probably null
R1899:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R1957:Anks1b UTSW 10 90049930 missense probably damaging 1.00
R2036:Anks1b UTSW 10 90969853 missense probably damaging 0.99
R2279:Anks1b UTSW 10 90050096 missense probably damaging 1.00
R2280:Anks1b UTSW 10 90966302 missense probably damaging 1.00
R2937:Anks1b UTSW 10 90077066 missense probably damaging 1.00
R3739:Anks1b UTSW 10 90033216 missense probably damaging 1.00
R4061:Anks1b UTSW 10 90307622 missense probably damaging 0.98
R4479:Anks1b UTSW 10 90049892 missense probably damaging 1.00
R4510:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4511:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4780:Anks1b UTSW 10 89873732 missense probably damaging 1.00
R4785:Anks1b UTSW 10 90914750 missense probably null 0.88
R4790:Anks1b UTSW 10 90163275 missense probably damaging 0.99
R5012:Anks1b UTSW 10 90359137 missense probably benign 0.06
R5400:Anks1b UTSW 10 90512824 missense probably damaging 1.00
R5586:Anks1b UTSW 10 90077064 missense probably damaging 0.98
R5687:Anks1b UTSW 10 90914711 missense probably benign 0.03
R5899:Anks1b UTSW 10 90923517 splice site probably null
R5917:Anks1b UTSW 10 90576941 intron probably benign
R5999:Anks1b UTSW 10 90359048 missense probably damaging 1.00
R6080:Anks1b UTSW 10 90966349 nonsense probably null
R6216:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R6265:Anks1b UTSW 10 90941500 missense probably damaging 1.00
R6298:Anks1b UTSW 10 90680837 missense probably damaging 1.00
R6337:Anks1b UTSW 10 90921296 missense probably benign 0.27
R6522:Anks1b UTSW 10 90897327 intron probably benign
R6843:Anks1b UTSW 10 90948598 missense probably damaging 1.00
R6852:Anks1b UTSW 10 90260654 missense probably damaging 1.00
R6933:Anks1b UTSW 10 90069490 missense probably damaging 1.00
R7114:Anks1b UTSW 10 90307698 missense probably damaging 1.00
R7211:Anks1b UTSW 10 90511070 missense possibly damaging 0.94
R7241:Anks1b UTSW 10 90512837 missense probably damaging 1.00
R7264:Anks1b UTSW 10 90512870 missense probably benign 0.08
R7325:Anks1b UTSW 10 90941432 missense probably damaging 1.00
R7392:Anks1b UTSW 10 90680786 missense possibly damaging 0.47
R7578:Anks1b UTSW 10 90049927 missense probably damaging 1.00
R7633:Anks1b UTSW 10 90948584 missense probably damaging 1.00
RF004:Anks1b UTSW 10 90033225 missense probably damaging 1.00
RF008:Anks1b UTSW 10 90033225 missense probably damaging 1.00
RF017:Anks1b UTSW 10 90033225 missense probably damaging 1.00
RF018:Anks1b UTSW 10 90033225 missense probably damaging 1.00
RF023:Anks1b UTSW 10 90033225 missense probably damaging 1.00
X0064:Anks1b UTSW 10 90512845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAAAGAGTATGATGCTGGGC -3'
(R):5'- GCATGTCGATCAAGGCTTTAG -3'

Sequencing Primer
(F):5'- ATGATGCTGGGCAATTCGC -3'
(R):5'- TCAAGGCTTTAGGCAATGACC -3'
Posted On2015-07-21