Incidental Mutation 'R4459:Prl7a2'
ID330070
Institutional Source Beutler Lab
Gene Symbol Prl7a2
Ensembl Gene ENSMUSG00000046899
Gene Nameprolactin family 7, subfamily a, member 2
SynonymsPLP-F, Prlpf
MMRRC Submission 041579-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4459 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location27658584-27668036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27665996 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 31 (V31A)
Ref Sequence ENSEMBL: ENSMUSP00000006660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006660]
Predicted Effect probably benign
Transcript: ENSMUST00000006660
AA Change: V31A

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000006660
Gene: ENSMUSG00000046899
AA Change: V31A

DomainStartEndE-ValueType
Pfam:Hormone_1 17 244 6.9e-45 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,745 L395P probably damaging Het
Abcc4 C T 14: 118,599,393 R652Q probably benign Het
Anks1b G A 10: 90,510,844 V669I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
BC049715 G A 6: 136,840,052 A97T probably damaging Het
Cyp11b1 T A 15: 74,836,359 E422D probably damaging Het
Dmxl1 A T 18: 49,961,216 I2920F possibly damaging Het
Efcab6 C T 15: 83,904,289 G935S probably damaging Het
Esp3 C G 17: 40,633,587 T40S probably null Het
Gc T C 5: 89,441,287 M206V probably benign Het
Gm15446 A T 5: 109,943,241 H453L probably benign Het
Hes6 A G 1: 91,412,339 S132P probably damaging Het
Ighg2b T C 12: 113,306,958 Y184C unknown Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kcnj5 A G 9: 32,322,395 I208T probably damaging Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Letm2 A G 8: 25,586,699 C296R probably damaging Het
Lrfn4 C T 19: 4,612,634 V452I probably benign Het
Mypn A G 10: 63,192,432 V284A probably damaging Het
Olfr1110 T C 2: 87,135,661 H220R probably benign Het
Olfr112 G A 17: 37,563,474 T279I probably damaging Het
Olfr1391 A T 11: 49,327,876 N155I probably damaging Het
Olfr898 T A 9: 38,349,992 V297D probably damaging Het
Pcdhgb6 C T 18: 37,742,706 P156S probably benign Het
Pih1d3 A G 1: 31,223,324 D129G probably damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rmnd5a C T 6: 71,396,881 G310R probably damaging Het
Rrm2b T A 15: 37,945,153 probably null Het
Smg8 T C 11: 87,085,570 D395G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tyk2 T C 9: 21,124,415 E157G probably damaging Het
Wdr90 T A 17: 25,861,002 T120S possibly damaging Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Prl7a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Prl7a2 APN 13 27659208 missense probably damaging 0.98
IGL02424:Prl7a2 APN 13 27667970 missense probably null 0.08
IGL02734:Prl7a2 APN 13 27659207 missense probably benign 0.38
IGL02823:Prl7a2 APN 13 27662751 missense possibly damaging 0.95
PIT4260001:Prl7a2 UTSW 13 27659276 nonsense probably null
R0733:Prl7a2 UTSW 13 27662688 missense probably damaging 1.00
R1371:Prl7a2 UTSW 13 27662767 missense probably benign 0.01
R1778:Prl7a2 UTSW 13 27659271 missense probably damaging 0.98
R1857:Prl7a2 UTSW 13 27659180 nonsense probably null
R2063:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2064:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2065:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2067:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2068:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2176:Prl7a2 UTSW 13 27659106 missense probably benign 0.10
R2213:Prl7a2 UTSW 13 27665068 missense probably benign 0.06
R4111:Prl7a2 UTSW 13 27665067 missense possibly damaging 0.96
R4483:Prl7a2 UTSW 13 27660947 missense possibly damaging 0.80
R4722:Prl7a2 UTSW 13 27660875 missense probably damaging 1.00
R5360:Prl7a2 UTSW 13 27659160 missense probably benign 0.22
R5778:Prl7a2 UTSW 13 27661000 nonsense probably null
R6667:Prl7a2 UTSW 13 27661041 missense probably benign 0.03
R7107:Prl7a2 UTSW 13 27659093 missense possibly damaging 0.89
R7600:Prl7a2 UTSW 13 27659281 missense possibly damaging 0.63
R8298:Prl7a2 UTSW 13 27661011 missense probably benign 0.00
R8447:Prl7a2 UTSW 13 27665958 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ACAGGACAATTTGACTGTGAAGTTC -3'
(R):5'- TGAAAACCCGCACAAATTCTTG -3'

Sequencing Primer
(F):5'- GTTCGTTTATGAAATAGACCAGAGC -3'
(R):5'- TCACAGTGAAAGATTCTTTTTCCC -3'
Posted On2015-07-21