Incidental Mutation 'R4459:Cyp11b1'
ID330074
Institutional Source Beutler Lab
Gene Symbol Cyp11b1
Ensembl Gene ENSMUSG00000075604
Gene Namecytochrome P450, family 11, subfamily b, polypeptide 1
SynonymsCyp11b-1, Cyp11b
MMRRC Submission 041579-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.436) question?
Stock #R4459 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location74834125-74841643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74836359 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 422 (E422D)
Ref Sequence ENSEMBL: ENSMUSP00000127888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170259] [ENSMUST00000188180]
Predicted Effect probably damaging
Transcript: ENSMUST00000170259
AA Change: E422D

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127888
Gene: ENSMUSG00000075604
AA Change: E422D

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:p450 44 497 4.3e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188180
SMART Domains Protein: ENSMUSP00000141185
Gene: ENSMUSG00000068600

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:LU 47 80 2e-15 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane. The enzyme has steroid 18-hydroxylase activity to synthesize aldosterone and 18-oxocortisol as well as steroid 11 beta-hydroxylase activity. Mutations in this gene cause corticosterone methyl oxidase deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit adrenal hypertrophy, abnormal organ weights, abnormal hormone levels, abnormal urine chemistry, hypokalemia, increased blood pressure, and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,745 L395P probably damaging Het
Abcc4 C T 14: 118,599,393 R652Q probably benign Het
Anks1b G A 10: 90,510,844 V669I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
BC049715 G A 6: 136,840,052 A97T probably damaging Het
Dmxl1 A T 18: 49,961,216 I2920F possibly damaging Het
Efcab6 C T 15: 83,904,289 G935S probably damaging Het
Esp3 C G 17: 40,633,587 T40S probably null Het
Gc T C 5: 89,441,287 M206V probably benign Het
Gm15446 A T 5: 109,943,241 H453L probably benign Het
Hes6 A G 1: 91,412,339 S132P probably damaging Het
Ighg2b T C 12: 113,306,958 Y184C unknown Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kcnj5 A G 9: 32,322,395 I208T probably damaging Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Letm2 A G 8: 25,586,699 C296R probably damaging Het
Lrfn4 C T 19: 4,612,634 V452I probably benign Het
Mypn A G 10: 63,192,432 V284A probably damaging Het
Olfr1110 T C 2: 87,135,661 H220R probably benign Het
Olfr112 G A 17: 37,563,474 T279I probably damaging Het
Olfr1391 A T 11: 49,327,876 N155I probably damaging Het
Olfr898 T A 9: 38,349,992 V297D probably damaging Het
Pcdhgb6 C T 18: 37,742,706 P156S probably benign Het
Pih1d3 A G 1: 31,223,324 D129G probably damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Prl7a2 A G 13: 27,665,996 V31A probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rmnd5a C T 6: 71,396,881 G310R probably damaging Het
Rrm2b T A 15: 37,945,153 probably null Het
Smg8 T C 11: 87,085,570 D395G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tyk2 T C 9: 21,124,415 E157G probably damaging Het
Wdr90 T A 17: 25,861,002 T120S possibly damaging Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Cyp11b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Cyp11b1 APN 15 74835853 unclassified probably null
IGL01154:Cyp11b1 APN 15 74838534 missense probably benign
IGL01982:Cyp11b1 APN 15 74839403 missense possibly damaging 0.69
IGL02156:Cyp11b1 APN 15 74835797 missense probably benign 0.25
IGL02424:Cyp11b1 APN 15 74839236 missense probably benign 0.23
IGL02937:Cyp11b1 APN 15 74836559 missense possibly damaging 0.81
IGL03080:Cyp11b1 APN 15 74839436 splice site probably null
IGL03101:Cyp11b1 APN 15 74835854 missense probably benign 0.39
R1230:Cyp11b1 UTSW 15 74840942 missense probably benign 0.01
R1699:Cyp11b1 UTSW 15 74840817 missense possibly damaging 0.89
R1755:Cyp11b1 UTSW 15 74838534 missense probably benign
R2913:Cyp11b1 UTSW 15 74836421 missense probably damaging 0.99
R4361:Cyp11b1 UTSW 15 74839016 missense possibly damaging 0.87
R5822:Cyp11b1 UTSW 15 74836821 missense probably null 1.00
R6921:Cyp11b1 UTSW 15 74840949 missense probably benign 0.00
R7214:Cyp11b1 UTSW 15 74836859 missense probably benign 0.00
R7402:Cyp11b1 UTSW 15 74840825 missense probably damaging 0.96
R7575:Cyp11b1 UTSW 15 74839313 missense probably benign 0.01
R7689:Cyp11b1 UTSW 15 74839048 missense probably benign 0.01
R7699:Cyp11b1 UTSW 15 74835842 missense probably damaging 1.00
R7700:Cyp11b1 UTSW 15 74835842 missense probably damaging 1.00
X0064:Cyp11b1 UTSW 15 74841587 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CACACCTCAGGCTCATAAACTTTG -3'
(R):5'- TGGTGCTTCAGAACTACCATG -3'

Sequencing Primer
(F):5'- CAGGCTCATAAACTTTGAAGACCTG -3'
(R):5'- AGAACTACCATGTCCCTGCTGG -3'
Posted On2015-07-21