Incidental Mutation 'R4459:Efcab6'
ID330075
Institutional Source Beutler Lab
Gene Symbol Efcab6
Ensembl Gene ENSMUSG00000022441
Gene NameEF-hand calcium binding domain 6
Synonyms4931407K02Rik, 4932408N08Rik
MMRRC Submission 041579-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4459 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location83866712-84065379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83904289 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 935 (G935S)
Ref Sequence ENSEMBL: ENSMUSP00000114909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000156187]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144169
Predicted Effect probably damaging
Transcript: ENSMUST00000156187
AA Change: G935S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114909
Gene: ENSMUSG00000022441
AA Change: G935S

DomainStartEndE-ValueType
EFh 100 128 9.33e-2 SMART
low complexity region 162 172 N/A INTRINSIC
EFh 201 229 5e-2 SMART
EFh 325 353 1.59e1 SMART
EFh 532 560 1.17e2 SMART
low complexity region 598 607 N/A INTRINSIC
EFh 659 687 8.82e1 SMART
EFh 767 795 3.71e0 SMART
low complexity region 802 816 N/A INTRINSIC
EFh 909 937 2.46e-1 SMART
low complexity region 962 977 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
EFh 1090 1118 2.09e0 SMART
low complexity region 1131 1136 N/A INTRINSIC
EFh 1197 1225 2e1 SMART
Blast:EFh 1233 1261 1e-9 BLAST
EFh 1342 1370 3.48e-1 SMART
EFh 1453 1481 2.49e0 SMART
Blast:EFh 1489 1516 6e-9 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which directly binds the oncogene DJ-1 and androgen receptor to form a ternary complex in cells. This binding protein recruits histone-deacetylase complexes in order to repress transcription activity of androgen receptor. This protein may also play a role in spermatogenesis and fertilization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,745 L395P probably damaging Het
Abcc4 C T 14: 118,599,393 R652Q probably benign Het
Anks1b G A 10: 90,510,844 V669I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
BC049715 G A 6: 136,840,052 A97T probably damaging Het
Cyp11b1 T A 15: 74,836,359 E422D probably damaging Het
Dmxl1 A T 18: 49,961,216 I2920F possibly damaging Het
Esp3 C G 17: 40,633,587 T40S probably null Het
Gc T C 5: 89,441,287 M206V probably benign Het
Gm15446 A T 5: 109,943,241 H453L probably benign Het
Hes6 A G 1: 91,412,339 S132P probably damaging Het
Ighg2b T C 12: 113,306,958 Y184C unknown Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kcnj5 A G 9: 32,322,395 I208T probably damaging Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Letm2 A G 8: 25,586,699 C296R probably damaging Het
Lrfn4 C T 19: 4,612,634 V452I probably benign Het
Mypn A G 10: 63,192,432 V284A probably damaging Het
Olfr1110 T C 2: 87,135,661 H220R probably benign Het
Olfr112 G A 17: 37,563,474 T279I probably damaging Het
Olfr1391 A T 11: 49,327,876 N155I probably damaging Het
Olfr898 T A 9: 38,349,992 V297D probably damaging Het
Pcdhgb6 C T 18: 37,742,706 P156S probably benign Het
Pih1d3 A G 1: 31,223,324 D129G probably damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Prl7a2 A G 13: 27,665,996 V31A probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rmnd5a C T 6: 71,396,881 G310R probably damaging Het
Rrm2b T A 15: 37,945,153 probably null Het
Smg8 T C 11: 87,085,570 D395G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tyk2 T C 9: 21,124,415 E157G probably damaging Het
Wdr90 T A 17: 25,861,002 T120S possibly damaging Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Efcab6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Efcab6 APN 15 84018642 missense probably benign 0.09
IGL00946:Efcab6 APN 15 84018696 missense probably benign 0.19
IGL01063:Efcab6 APN 15 84054512 start codon destroyed probably null 0.53
IGL01330:Efcab6 APN 15 84044300 missense probably benign 0.26
IGL01372:Efcab6 APN 15 84044304 missense possibly damaging 0.62
IGL01644:Efcab6 APN 15 84033072 missense probably damaging 0.97
IGL02175:Efcab6 APN 15 83896100 missense probably damaging 0.98
IGL02449:Efcab6 APN 15 84010033 missense probably benign 0.00
IGL02514:Efcab6 APN 15 84032942 missense possibly damaging 0.91
IGL02514:Efcab6 APN 15 83871311 splice site probably benign
IGL02538:Efcab6 APN 15 84054521 start gained probably benign
IGL02623:Efcab6 APN 15 83879448 missense probably damaging 0.99
IGL02735:Efcab6 APN 15 83899697 missense probably damaging 1.00
IGL03139:Efcab6 APN 15 83952221 missense probably benign 0.04
IGL03274:Efcab6 APN 15 83868249 missense probably damaging 1.00
IGL03400:Efcab6 APN 15 83867045 utr 3 prime probably benign
P0045:Efcab6 UTSW 15 83918199 missense probably damaging 1.00
PIT4445001:Efcab6 UTSW 15 83904267 missense probably benign 0.03
PIT4486001:Efcab6 UTSW 15 83973313 missense probably benign 0.00
PIT4618001:Efcab6 UTSW 15 83983446 missense probably benign 0.25
R0520:Efcab6 UTSW 15 83950046 missense probably benign 0.00
R0575:Efcab6 UTSW 15 83967700 missense probably benign 0.28
R0648:Efcab6 UTSW 15 83933064 splice site probably benign
R0894:Efcab6 UTSW 15 83918292 missense probably benign 0.00
R0975:Efcab6 UTSW 15 83973331 missense probably benign 0.00
R1238:Efcab6 UTSW 15 83933137 missense probably benign 0.06
R1625:Efcab6 UTSW 15 83947638 missense probably benign
R1651:Efcab6 UTSW 15 83870993 missense possibly damaging 0.50
R1691:Efcab6 UTSW 15 83933206 missense probably benign 0.01
R1844:Efcab6 UTSW 15 83967621 missense possibly damaging 0.47
R1929:Efcab6 UTSW 15 83892962 splice site probably benign
R1983:Efcab6 UTSW 15 83892962 splice site probably benign
R2100:Efcab6 UTSW 15 83892967 splice site probably null
R2271:Efcab6 UTSW 15 83946999 missense probably benign
R2329:Efcab6 UTSW 15 83950048 missense possibly damaging 0.90
R3618:Efcab6 UTSW 15 83950069 missense probably benign 0.00
R3687:Efcab6 UTSW 15 83871278 nonsense probably null
R3688:Efcab6 UTSW 15 83871278 nonsense probably null
R4212:Efcab6 UTSW 15 83892863 missense probably damaging 1.00
R4223:Efcab6 UTSW 15 83867108 missense probably damaging 1.00
R4578:Efcab6 UTSW 15 83933168 missense probably benign 0.00
R4600:Efcab6 UTSW 15 83946925 missense probably benign
R5174:Efcab6 UTSW 15 84054486 missense probably benign
R5260:Efcab6 UTSW 15 83945123 missense probably benign 0.01
R5576:Efcab6 UTSW 15 83950000 missense probably benign 0.05
R5718:Efcab6 UTSW 15 83904238 missense probably damaging 1.00
R5797:Efcab6 UTSW 15 83924277 missense possibly damaging 0.82
R6027:Efcab6 UTSW 15 83967721 missense probably benign
R6110:Efcab6 UTSW 15 83879634 missense possibly damaging 0.69
R6132:Efcab6 UTSW 15 84032972 missense probably damaging 1.00
R6166:Efcab6 UTSW 15 83896115 missense probably benign 0.01
R6228:Efcab6 UTSW 15 83967624 missense possibly damaging 0.67
R6341:Efcab6 UTSW 15 83935938 missense possibly damaging 0.65
R6445:Efcab6 UTSW 15 83868357 missense probably damaging 1.00
R6494:Efcab6 UTSW 15 84044322 critical splice acceptor site probably null
R6611:Efcab6 UTSW 15 83892835 missense possibly damaging 0.68
R7392:Efcab6 UTSW 15 83988951 missense probably benign 0.39
R7599:Efcab6 UTSW 15 83870988 missense probably damaging 1.00
R7711:Efcab6 UTSW 15 83949924 missense probably benign 0.00
X0019:Efcab6 UTSW 15 83879483 missense possibly damaging 0.92
X0064:Efcab6 UTSW 15 83983493 missense probably benign 0.08
Z1088:Efcab6 UTSW 15 83955009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGCAGCCTTACAAGAGCC -3'
(R):5'- TGGCCTTGCTTGTACCTGAC -3'

Sequencing Primer
(F):5'- GCCTTACAAGAGCCCTGTCAG -3'
(R):5'- GCTGACAGCACTGTCTTT -3'
Posted On2015-07-21