Incidental Mutation 'R4459:Arsi'
ID330082
Institutional Source Beutler Lab
Gene Symbol Arsi
Ensembl Gene ENSMUSG00000036412
Gene Namearylsulfatase i
Synonyms
MMRRC Submission 041579-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4459 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location60911780-60918561 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60916651 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 202 (G202E)
Ref Sequence ENSEMBL: ENSMUSP00000043966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040359]
Predicted Effect probably benign
Transcript: ENSMUST00000040359
AA Change: G202E

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000043966
Gene: ENSMUSG00000036412
AA Change: G202E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Sulfatase 47 360 8.2e-73 PFAM
low complexity region 526 537 N/A INTRINSIC
low complexity region 547 556 N/A INTRINSIC
Meta Mutation Damage Score 0.0626 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a large family of sulfatases that hydrolyze sulfate esters and sulfamates. Members of this family play a role in several cellular processes, including hormone synthesis, cell signaling in development and degradation of macromolecules. The protein encoded by this gene is thought to be secreted, and to function in extracellular space. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,745 L395P probably damaging Het
Abcc4 C T 14: 118,599,393 R652Q probably benign Het
Anks1b G A 10: 90,510,844 V669I probably damaging Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
BC049715 G A 6: 136,840,052 A97T probably damaging Het
Cyp11b1 T A 15: 74,836,359 E422D probably damaging Het
Dmxl1 A T 18: 49,961,216 I2920F possibly damaging Het
Efcab6 C T 15: 83,904,289 G935S probably damaging Het
Esp3 C G 17: 40,633,587 T40S probably null Het
Gc T C 5: 89,441,287 M206V probably benign Het
Gm15446 A T 5: 109,943,241 H453L probably benign Het
Hes6 A G 1: 91,412,339 S132P probably damaging Het
Ighg2b T C 12: 113,306,958 Y184C unknown Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kcnj5 A G 9: 32,322,395 I208T probably damaging Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Letm2 A G 8: 25,586,699 C296R probably damaging Het
Lrfn4 C T 19: 4,612,634 V452I probably benign Het
Mypn A G 10: 63,192,432 V284A probably damaging Het
Olfr1110 T C 2: 87,135,661 H220R probably benign Het
Olfr112 G A 17: 37,563,474 T279I probably damaging Het
Olfr1391 A T 11: 49,327,876 N155I probably damaging Het
Olfr898 T A 9: 38,349,992 V297D probably damaging Het
Pcdhgb6 C T 18: 37,742,706 P156S probably benign Het
Pih1d3 A G 1: 31,223,324 D129G probably damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Prl7a2 A G 13: 27,665,996 V31A probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rmnd5a C T 6: 71,396,881 G310R probably damaging Het
Rrm2b T A 15: 37,945,153 probably null Het
Smg8 T C 11: 87,085,570 D395G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tyk2 T C 9: 21,124,415 E157G probably damaging Het
Wdr90 T A 17: 25,861,002 T120S possibly damaging Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Arsi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Arsi APN 18 60912430 missense probably damaging 1.00
IGL02519:Arsi APN 18 60917067 missense probably damaging 1.00
IGL03186:Arsi APN 18 60917473 missense probably damaging 1.00
IGL03134:Arsi UTSW 18 60917352 missense probably damaging 1.00
R0003:Arsi UTSW 18 60916986 missense probably benign 0.29
R0003:Arsi UTSW 18 60916986 missense probably benign 0.29
R0448:Arsi UTSW 18 60917302 missense probably damaging 0.98
R1147:Arsi UTSW 18 60916651 missense probably benign 0.07
R1147:Arsi UTSW 18 60916651 missense probably benign 0.07
R1148:Arsi UTSW 18 60916651 missense probably benign 0.07
R1148:Arsi UTSW 18 60916651 missense probably benign 0.07
R1190:Arsi UTSW 18 60916651 missense probably benign 0.07
R1261:Arsi UTSW 18 60916671 missense probably damaging 1.00
R1511:Arsi UTSW 18 60916651 missense probably benign 0.07
R1538:Arsi UTSW 18 60916651 missense probably benign 0.07
R1635:Arsi UTSW 18 60916651 missense probably benign 0.07
R1641:Arsi UTSW 18 60916651 missense probably benign 0.07
R1759:Arsi UTSW 18 60916651 missense probably benign 0.07
R1794:Arsi UTSW 18 60916651 missense probably benign 0.07
R1822:Arsi UTSW 18 60916651 missense probably benign 0.07
R1824:Arsi UTSW 18 60912297 missense probably damaging 1.00
R1824:Arsi UTSW 18 60916651 missense probably benign 0.07
R1930:Arsi UTSW 18 60916651 missense probably benign 0.07
R1932:Arsi UTSW 18 60916651 missense probably benign 0.07
R1983:Arsi UTSW 18 60916651 missense probably benign 0.07
R2035:Arsi UTSW 18 60916651 missense probably benign 0.07
R2036:Arsi UTSW 18 60916651 missense probably benign 0.07
R2108:Arsi UTSW 18 60916371 missense possibly damaging 0.75
R2166:Arsi UTSW 18 60916651 missense probably benign 0.07
R2168:Arsi UTSW 18 60916651 missense probably benign 0.07
R2261:Arsi UTSW 18 60916665 missense probably damaging 1.00
R2263:Arsi UTSW 18 60916665 missense probably damaging 1.00
R2299:Arsi UTSW 18 60916651 missense probably benign 0.07
R2300:Arsi UTSW 18 60916651 missense probably benign 0.07
R2393:Arsi UTSW 18 60916651 missense probably benign 0.07
R2402:Arsi UTSW 18 60916467 missense possibly damaging 0.88
R2484:Arsi UTSW 18 60916651 missense probably benign 0.07
R2511:Arsi UTSW 18 60916594 missense probably damaging 1.00
R2994:Arsi UTSW 18 60916651 missense probably benign 0.07
R2995:Arsi UTSW 18 60916651 missense probably benign 0.07
R2996:Arsi UTSW 18 60916651 missense probably benign 0.07
R2997:Arsi UTSW 18 60916651 missense probably benign 0.07
R3625:Arsi UTSW 18 60916651 missense probably benign 0.07
R3694:Arsi UTSW 18 60916651 missense probably benign 0.07
R3695:Arsi UTSW 18 60916651 missense probably benign 0.07
R3883:Arsi UTSW 18 60916651 missense probably benign 0.07
R3884:Arsi UTSW 18 60916651 missense probably benign 0.07
R3907:Arsi UTSW 18 60916651 missense probably benign 0.07
R3932:Arsi UTSW 18 60916651 missense probably benign 0.07
R3954:Arsi UTSW 18 60916651 missense probably benign 0.07
R4212:Arsi UTSW 18 60916701 missense probably damaging 1.00
R4256:Arsi UTSW 18 60917316 missense probably damaging 1.00
R4257:Arsi UTSW 18 60916651 missense probably benign 0.07
R4258:Arsi UTSW 18 60917316 missense probably damaging 1.00
R4469:Arsi UTSW 18 60916651 missense probably benign 0.07
R4601:Arsi UTSW 18 60916651 missense probably benign 0.07
R4603:Arsi UTSW 18 60916651 missense probably benign 0.07
R4610:Arsi UTSW 18 60916651 missense probably benign 0.07
R4649:Arsi UTSW 18 60916651 missense probably benign 0.07
R4649:Arsi UTSW 18 60917098 missense probably damaging 1.00
R4650:Arsi UTSW 18 60916651 missense probably benign 0.07
R4651:Arsi UTSW 18 60916651 missense probably benign 0.07
R4652:Arsi UTSW 18 60916651 missense probably benign 0.07
R4749:Arsi UTSW 18 60917461 missense probably benign 0.23
R4766:Arsi UTSW 18 60916651 missense probably benign 0.07
R4807:Arsi UTSW 18 60916651 missense probably benign 0.07
R4808:Arsi UTSW 18 60916651 missense probably benign 0.07
R4856:Arsi UTSW 18 60916651 missense probably benign 0.07
R4860:Arsi UTSW 18 60916651 missense probably benign 0.07
R4860:Arsi UTSW 18 60916651 missense probably benign 0.07
R4886:Arsi UTSW 18 60916651 missense probably benign 0.07
R5015:Arsi UTSW 18 60916651 missense probably benign 0.07
R5121:Arsi UTSW 18 60917439 missense probably damaging 1.00
R5185:Arsi UTSW 18 60916912 missense probably damaging 1.00
R6191:Arsi UTSW 18 60912472 missense probably damaging 1.00
R6197:Arsi UTSW 18 60916651 missense probably benign 0.07
R6218:Arsi UTSW 18 60916651 missense probably benign 0.07
R6219:Arsi UTSW 18 60916651 missense probably benign 0.07
R6220:Arsi UTSW 18 60916651 missense probably benign 0.07
R6378:Arsi UTSW 18 60916501 missense probably damaging 1.00
R6612:Arsi UTSW 18 60912456 missense probably benign 0.12
R6871:Arsi UTSW 18 60916651 missense probably benign 0.07
R7813:Arsi UTSW 18 60916654 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TACAGGATTGCAGCACTCCATTATC -3'
(R):5'- TCACCATGGCTGCGTACTTG -3'

Sequencing Primer
(F):5'- TACAGGAGGCAGGCTACTC -3'
(R):5'- TACTTGCGCCGTGCTACG -3'
Posted On2015-07-21