Incidental Mutation 'R4460:Kirrel'
ID330092
Institutional Source Beutler Lab
Gene Symbol Kirrel
Ensembl Gene ENSMUSG00000041734
Gene Namekirre like nephrin family adhesion molecule 1
SynonymsKirrel1, 6720469N11Rik, Neph1
MMRRC Submission 041719-MU
Accession Numbers

Genbank: NM_130867; MGI: 1891396

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4460 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87078593-87174747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87089151 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 380 (M380I)
Ref Sequence ENSEMBL: ENSMUSP00000125525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]
Predicted Effect probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Meta Mutation Damage Score 0.0922 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]
Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,152,856 T1268I probably benign Het
A830010M20Rik A G 5: 107,503,765 T687A possibly damaging Het
C030048H21Rik A G 2: 26,255,863 probably null Het
Cav1 A G 6: 17,306,472 D8G probably damaging Het
Celf6 G A 9: 59,603,044 R103H probably damaging Het
Ctr9 A G 7: 111,046,894 I698V probably benign Het
Cts6 G C 13: 61,195,458 I316M probably benign Het
Dnajc13 C A 9: 104,181,063 R1496L probably damaging Het
Dscam A G 16: 96,610,319 Y1786H probably damaging Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Ltk A G 2: 119,755,613 probably null Het
Med20 T C 17: 47,618,917 V93A probably benign Het
Mmp9 G T 2: 164,949,038 K115N probably damaging Het
Mroh5 A T 15: 73,791,796 D339E probably damaging Het
Muc1 A T 3: 89,231,563 D493V probably damaging Het
Mx1 G T 16: 97,454,081 S113R probably damaging Het
Nlrp9c T A 7: 26,378,098 H698L probably damaging Het
Nol9 T G 4: 152,057,836 L641R probably damaging Het
Park2 A T 17: 12,061,646 D463V probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Ptcd1 G T 5: 145,159,506 A259E probably benign Het
Ptov1 T C 7: 44,865,576 M204V probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rbbp8nl A G 2: 180,280,971 S210P probably benign Het
Rgmb C A 17: 15,807,626 R277L probably benign Het
Snx2 A G 18: 53,176,444 E22G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tmem143 C T 7: 45,906,952 T97I probably damaging Het
Ttn A C 2: 76,814,647 F12955V probably damaging Het
Ubr2 C T 17: 46,945,045 probably null Het
Vmn1r203 T A 13: 22,524,682 M211K probably damaging Het
Vmn2r121 G A X: 124,128,584 P580S probably benign Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Kirrel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Kirrel APN 3 87089875 missense probably benign 0.22
IGL01865:Kirrel APN 3 87086424 missense probably damaging 1.00
IGL01875:Kirrel APN 3 87095730 missense probably damaging 1.00
IGL02337:Kirrel APN 3 87089212 missense possibly damaging 0.64
IGL02724:Kirrel APN 3 87090473 nonsense probably null
IGL02825:Kirrel APN 3 87089288 splice site probably benign
IGL02826:Kirrel APN 3 87088485 missense probably damaging 1.00
IGL03102:Kirrel APN 3 87083500 missense probably damaging 0.98
D4043:Kirrel UTSW 3 87083203 missense probably benign 0.02
R0360:Kirrel UTSW 3 87089799 missense probably damaging 1.00
R0364:Kirrel UTSW 3 87089799 missense probably damaging 1.00
R0421:Kirrel UTSW 3 87083607 missense probably damaging 0.99
R0503:Kirrel UTSW 3 87097802 missense probably benign 0.20
R1112:Kirrel UTSW 3 87089151 missense probably null 0.46
R1116:Kirrel UTSW 3 87089151 missense probably null 0.46
R1144:Kirrel UTSW 3 87089151 missense probably null 0.46
R1147:Kirrel UTSW 3 87089151 missense probably null 0.46
R1147:Kirrel UTSW 3 87089151 missense probably null 0.46
R1190:Kirrel UTSW 3 87089151 missense probably null 0.46
R1226:Kirrel UTSW 3 87089151 missense probably null 0.46
R1501:Kirrel UTSW 3 87090472 missense probably benign 0.02
R1538:Kirrel UTSW 3 87089151 missense probably null 0.46
R1546:Kirrel UTSW 3 87089151 missense probably null 0.46
R1628:Kirrel UTSW 3 87089151 missense probably null 0.46
R1630:Kirrel UTSW 3 87089151 missense probably null 0.46
R1631:Kirrel UTSW 3 87089151 missense probably null 0.46
R1664:Kirrel UTSW 3 87089151 missense probably null 0.46
R1671:Kirrel UTSW 3 87089151 missense probably null 0.46
R1695:Kirrel UTSW 3 87089151 missense probably null 0.46
R1769:Kirrel UTSW 3 87089151 missense probably null 0.46
R1807:Kirrel UTSW 3 87089151 missense probably null 0.46
R1808:Kirrel UTSW 3 87089151 missense probably null 0.46
R1840:Kirrel UTSW 3 87089151 missense probably null 0.46
R1876:Kirrel UTSW 3 87089151 missense probably null 0.46
R1995:Kirrel UTSW 3 87095786 missense possibly damaging 0.88
R2014:Kirrel UTSW 3 87089151 missense probably null 0.46
R2086:Kirrel UTSW 3 87089151 missense probably null 0.46
R2108:Kirrel UTSW 3 87089151 missense probably null 0.46
R2354:Kirrel UTSW 3 87088485 missense probably damaging 0.98
R2407:Kirrel UTSW 3 87084843 missense probably benign 0.03
R2904:Kirrel UTSW 3 87089151 missense probably null 0.46
R2905:Kirrel UTSW 3 87089151 missense probably null 0.46
R2958:Kirrel UTSW 3 87089151 missense probably null 0.46
R2959:Kirrel UTSW 3 87089151 missense probably null 0.46
R2960:Kirrel UTSW 3 87089151 missense probably null 0.46
R2961:Kirrel UTSW 3 87089151 missense probably null 0.46
R3026:Kirrel UTSW 3 87089151 missense probably null 0.46
R3028:Kirrel UTSW 3 87089151 missense probably null 0.46
R3034:Kirrel UTSW 3 87083439 missense possibly damaging 0.56
R3149:Kirrel UTSW 3 87089151 missense probably null 0.46
R3195:Kirrel UTSW 3 87089151 missense probably null 0.46
R3196:Kirrel UTSW 3 87089151 missense probably null 0.46
R3499:Kirrel UTSW 3 87089151 missense probably null 0.46
R3699:Kirrel UTSW 3 87089151 missense probably null 0.46
R3720:Kirrel UTSW 3 87089151 missense probably null 0.46
R3721:Kirrel UTSW 3 87089151 missense probably null 0.46
R3788:Kirrel UTSW 3 87089151 missense probably null 0.46
R3793:Kirrel UTSW 3 87089151 missense probably null 0.46
R3876:Kirrel UTSW 3 87089151 missense probably null 0.46
R3877:Kirrel UTSW 3 87089151 missense probably null 0.46
R3901:Kirrel UTSW 3 87089151 missense probably null 0.46
R3910:Kirrel UTSW 3 87089151 missense probably null 0.46
R3911:Kirrel UTSW 3 87089151 missense probably null 0.46
R3912:Kirrel UTSW 3 87089151 missense probably null 0.46
R3913:Kirrel UTSW 3 87089151 missense probably null 0.46
R3930:Kirrel UTSW 3 87089151 missense probably null 0.46
R3931:Kirrel UTSW 3 87089151 missense probably null 0.46
R4022:Kirrel UTSW 3 87089151 missense probably null 0.46
R4067:Kirrel UTSW 3 87088467 nonsense probably null
R4077:Kirrel UTSW 3 87085080 critical splice donor site probably null
R4198:Kirrel UTSW 3 87089151 missense probably null 0.46
R4328:Kirrel UTSW 3 87084774 intron probably benign
R4355:Kirrel UTSW 3 87089151 missense probably null 0.46
R4363:Kirrel UTSW 3 87090485 nonsense probably null
R4378:Kirrel UTSW 3 87089151 missense probably null 0.46
R4386:Kirrel UTSW 3 87089151 missense probably null 0.46
R4468:Kirrel UTSW 3 87089151 missense probably null 0.46
R4469:Kirrel UTSW 3 87089151 missense probably null 0.46
R4650:Kirrel UTSW 3 87089151 missense probably null 0.46
R4652:Kirrel UTSW 3 87089151 missense probably null 0.46
R4734:Kirrel UTSW 3 87089151 missense probably null 0.46
R4748:Kirrel UTSW 3 87089151 missense probably null 0.46
R4749:Kirrel UTSW 3 87089151 missense probably null 0.46
R5304:Kirrel UTSW 3 87089595 missense probably benign 0.02
R5534:Kirrel UTSW 3 87090518 missense probably damaging 1.00
R5604:Kirrel UTSW 3 87089155 missense possibly damaging 0.69
R7199:Kirrel UTSW 3 87083388 missense probably benign 0.02
R7221:Kirrel UTSW 3 87086397 nonsense probably null
R7284:Kirrel UTSW 3 87083387 missense probably benign 0.02
R7332:Kirrel UTSW 3 87088398 missense probably benign 0.14
R7369:Kirrel UTSW 3 87141084 missense probably benign 0.20
R7371:Kirrel UTSW 3 87088422 missense probably benign 0.44
R7508:Kirrel UTSW 3 87083439 missense possibly damaging 0.56
R7566:Kirrel UTSW 3 87088484 missense probably damaging 1.00
R7567:Kirrel UTSW 3 87095681 missense probably damaging 0.99
R7621:Kirrel UTSW 3 87088221 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ACCCTGAGTTCTATGCAAGTC -3'
(R):5'- AGCTGATGATTCTCAGGCACC -3'

Sequencing Primer
(F):5'- TATGGCTGACTGCAAGTACC -3'
(R):5'- TCAGGCACCTGAGACTCTGAC -3'
Posted On2015-07-21