Incidental Mutation 'R4460:Cav1'
ID330101
Institutional Source Beutler Lab
Gene Symbol Cav1
Ensembl Gene ENSMUSG00000007655
Gene Namecaveolin 1, caveolae protein
Synonymscaveolin-1, Cav-1
MMRRC Submission 041719-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.410) question?
Stock #R4460 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location17306335-17341452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17306472 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 8 (D8G)
Ref Sequence ENSEMBL: ENSMUSP00000135374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007799] [ENSMUST00000115453] [ENSMUST00000115454] [ENSMUST00000115455] [ENSMUST00000115456] [ENSMUST00000123439] [ENSMUST00000150901] [ENSMUST00000177234]
Predicted Effect probably benign
Transcript: ENSMUST00000007799
AA Change: D8G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007799
Gene: ENSMUSG00000007655
AA Change: D8G

DomainStartEndE-ValueType
Pfam:Caveolin 27 177 4.1e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115453
SMART Domains Protein: ENSMUSP00000111113
Gene: ENSMUSG00000007655

DomainStartEndE-ValueType
Pfam:Caveolin 1 146 2e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115454
SMART Domains Protein: ENSMUSP00000111114
Gene: ENSMUSG00000007655

DomainStartEndE-ValueType
Pfam:Caveolin 1 146 2e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115455
AA Change: D8G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111115
Gene: ENSMUSG00000007655
AA Change: D8G

DomainStartEndE-ValueType
Pfam:Caveolin 16 115 2.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115456
AA Change: D8G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111116
Gene: ENSMUSG00000007655
AA Change: D8G

DomainStartEndE-ValueType
Pfam:Caveolin 42 175 1.1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133065
Predicted Effect probably damaging
Transcript: ENSMUST00000150901
AA Change: D8G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect unknown
Transcript: ENSMUST00000177234
AA Change: D8G
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The scaffolding protein encoded by this gene is the main component of the caveolae plasma membranes found in most cell types. The protein links integrin subunits to the tyrosine kinase FYN, an initiating step in coupling integrins to the Ras-ERK pathway and promoting cell cycle progression. The gene is a tumor suppressor gene candidate and a negative regulator of the Ras-p42/44 mitogen-activated kinase cascade. Caveolin 1 and caveolin 2 are located next to each other on chromosome 7 and express colocalizing proteins that form a stable hetero-oligomeric complex. Mutations in this gene have been associated with Berardinelli-Seip congenital lipodystrophy. Alternatively spliced transcripts encode alpha and beta isoforms of caveolin 1.[provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous targeted mutants displayed vascular system dysfunctions and thickening of lung aveloar septa from hyperproliferation and fibrosis, ultimately causing the mice physical limitations. Mice also display increased incidence of calcium calculi, kidney stones, and decreased adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,152,856 T1268I probably benign Het
A830010M20Rik A G 5: 107,503,765 T687A possibly damaging Het
C030048H21Rik A G 2: 26,255,863 probably null Het
Celf6 G A 9: 59,603,044 R103H probably damaging Het
Ctr9 A G 7: 111,046,894 I698V probably benign Het
Cts6 G C 13: 61,195,458 I316M probably benign Het
Dnajc13 C A 9: 104,181,063 R1496L probably damaging Het
Dscam A G 16: 96,610,319 Y1786H probably damaging Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Ltk A G 2: 119,755,613 probably null Het
Med20 T C 17: 47,618,917 V93A probably benign Het
Mmp9 G T 2: 164,949,038 K115N probably damaging Het
Mroh5 A T 15: 73,791,796 D339E probably damaging Het
Muc1 A T 3: 89,231,563 D493V probably damaging Het
Mx1 G T 16: 97,454,081 S113R probably damaging Het
Nlrp9c T A 7: 26,378,098 H698L probably damaging Het
Nol9 T G 4: 152,057,836 L641R probably damaging Het
Park2 A T 17: 12,061,646 D463V probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Ptcd1 G T 5: 145,159,506 A259E probably benign Het
Ptov1 T C 7: 44,865,576 M204V probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rbbp8nl A G 2: 180,280,971 S210P probably benign Het
Rgmb C A 17: 15,807,626 R277L probably benign Het
Snx2 A G 18: 53,176,444 E22G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tmem143 C T 7: 45,906,952 T97I probably damaging Het
Ttn A C 2: 76,814,647 F12955V probably damaging Het
Ubr2 C T 17: 46,945,045 probably null Het
Vmn1r203 T A 13: 22,524,682 M211K probably damaging Het
Vmn2r121 G A X: 124,128,584 P580S probably benign Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Cav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:Cav1 APN 6 17307972 missense possibly damaging 0.93
R0113:Cav1 UTSW 6 17308049 missense possibly damaging 0.60
R0149:Cav1 UTSW 6 17339353 missense possibly damaging 0.46
R0361:Cav1 UTSW 6 17339353 missense possibly damaging 0.46
R1706:Cav1 UTSW 6 17339182 missense probably damaging 0.96
R1930:Cav1 UTSW 6 17339332 missense probably damaging 1.00
R1931:Cav1 UTSW 6 17339332 missense probably damaging 1.00
R2166:Cav1 UTSW 6 17339431 missense possibly damaging 0.69
R2655:Cav1 UTSW 6 17339360 missense probably damaging 1.00
R4416:Cav1 UTSW 6 17339249 missense probably benign 0.36
R5204:Cav1 UTSW 6 17339255 missense probably damaging 1.00
R5956:Cav1 UTSW 6 17307919 missense probably damaging 1.00
R6467:Cav1 UTSW 6 17308035 missense probably damaging 0.99
R7041:Cav1 UTSW 6 17339144 missense possibly damaging 0.70
X0026:Cav1 UTSW 6 17339162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTCCTAGCCAACTGAGAG -3'
(R):5'- TGGTCTCCTCTCCAAAAGGAAG -3'

Sequencing Primer
(F):5'- GTCCTAGCCAACTGAGAGCAGAAC -3'
(R):5'- GGAAGCCCTAAGACATTCCTAG -3'
Posted On2015-07-21