Mutagenetix > Incidental Mutation

Incidental Mutation 'R4460:9530053A07Rik'

330103

Institutional Source

Beutler Lab

Gene Symbol

9530053A07Rik

Ensembl Gene

ENSMUSG00000078776

Gene Name

RIKEN cDNA 9530053A07 gene

Synonyms

MMRRC Submission

041719-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R4460 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

28129466-28164811 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 28152856 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1268 (T1268I)

Ref Sequence

ENSEMBL: ENSMUSP00000114986 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]

AlphaFold

E9PVG8

Predicted Effect

probably benign
Transcript: ENSMUST00000059886
AA Change: T1268I

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: T1268I

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
FOLN	27	49	1.23e-4	SMART
VWD	46	211	1.5e-40	SMART
C8	251	326	4.31e-33	SMART
Pfam:TIL	329	383	2e-13	PFAM
VWC	385	448	1.02e0	SMART
VWD	439	603	4.32e-32	SMART
C8	640	715	4.54e-9	SMART
Pfam:TIL	718	771	1.6e-12	PFAM
VWC	773	826	1.1e0	SMART
FOLN	805	827	6.87e1	SMART
VWD	825	988	7.92e-40	SMART
C8	1033	1108	5.1e-35	SMART
Pfam:TIL	1111	1164	7.6e-11	PFAM
VWC	1166	1224	1.1e-2	SMART
FOLN	1197	1219	9.55e-1	SMART
FOLN	1223	1245	5.38e1	SMART
VWD	1241	1410	9.04e-35	SMART
C8	1450	1526	9.54e-26	SMART
low complexity region	1540	1550	N/A	INTRINSIC
EGF_like	1557	1580	5.34e1	SMART
VWC	1588	1681	3.21e-3	SMART
VWD	1639	1806	7.3e-30	SMART
C8	1838	1913	2.44e-32	SMART
EGF_like	1941	1964	4.46e1	SMART
VWC	1971	2062	2.85e-1	SMART
VWD	2022	2178	1.32e-27	SMART
low complexity region	2199	2212	N/A	INTRINSIC
C8	2219	2294	1.43e-29	SMART
Pfam:TIL	2297	2350	1.1e-11	PFAM
FOLN	2383	2405	5.68e1	SMART
VWD	2402	2564	4.58e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000150948
AA Change: T1268I

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: T1268I

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
FOLN	27	49	1.23e-4	SMART
VWD	46	211	1.5e-40	SMART
C8	251	326	4.31e-33	SMART
Pfam:TIL	329	383	2e-13	PFAM
VWC	385	448	1.02e0	SMART
VWD	439	603	4.32e-32	SMART
C8	640	715	4.54e-9	SMART
Pfam:TIL	718	771	1.6e-12	PFAM
VWC	773	826	1.1e0	SMART
FOLN	805	827	6.87e1	SMART
VWD	825	988	7.92e-40	SMART
C8	1033	1108	5.1e-35	SMART
Pfam:TIL	1111	1164	7.6e-11	PFAM
VWC	1166	1224	1.1e-2	SMART
FOLN	1197	1219	9.55e-1	SMART
FOLN	1223	1245	5.38e1	SMART
VWD	1241	1410	9.04e-35	SMART
C8	1450	1526	9.54e-26	SMART
low complexity region	1540	1550	N/A	INTRINSIC
EGF_like	1557	1580	5.34e1	SMART
VWC	1588	1681	3.21e-3	SMART
VWD	1639	1806	7.3e-30	SMART
C8	1838	1913	2.44e-32	SMART
EGF_like	1941	1964	4.46e1	SMART
VWC	1971	2062	2.85e-1	SMART
VWD	2022	2178	1.32e-27	SMART
low complexity region	2199	2212	N/A	INTRINSIC
C8	2219	2294	1.43e-29	SMART
Pfam:TIL	2297	2350	1.1e-11	PFAM
FOLN	2383	2405	5.68e1	SMART
VWD	2402	2564	4.58e-4	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	A	G	5: 107,503,765 (GRCm38)	T687A	possibly damaging	Het
C030048H21Rik	A	G	2: 26,255,863 (GRCm38)		probably null	Het
Cav1	A	G	6: 17,306,472 (GRCm38)	D8G	probably damaging	Het
Celf6	G	A	9: 59,603,044 (GRCm38)	R103H	probably damaging	Het
Ctr9	A	G	7: 111,046,894 (GRCm38)	I698V	probably benign	Het
Cts6	G	C	13: 61,195,458 (GRCm38)	I316M	probably benign	Het
Dnajc13	C	A	9: 104,181,063 (GRCm38)	R1496L	probably damaging	Het
Dscam	A	G	16: 96,610,319 (GRCm38)	Y1786H	probably damaging	Het
Itga2	C	G	13: 114,843,483 (GRCm38)	D1061H	probably damaging	Het
Kirrel	C	T	3: 87,089,151 (GRCm38)	M380I	probably null	Het
Klhl26	T	C	8: 70,451,544 (GRCm38)	Y538C	probably damaging	Het
Ltk	A	G	2: 119,755,613 (GRCm38)		probably null	Het
Med20	T	C	17: 47,618,917 (GRCm38)	V93A	probably benign	Het
Mmp9	G	T	2: 164,949,038 (GRCm38)	K115N	probably damaging	Het
Mroh5	A	T	15: 73,791,796 (GRCm38)	D339E	probably damaging	Het
Muc1	A	T	3: 89,231,563 (GRCm38)	D493V	probably damaging	Het
Mx1	G	T	16: 97,454,081 (GRCm38)	S113R	probably damaging	Het
Nlrp9c	T	A	7: 26,378,098 (GRCm38)	H698L	probably damaging	Het
Nol9	T	G	4: 152,057,836 (GRCm38)	L641R	probably damaging	Het
Park2	A	T	17: 12,061,646 (GRCm38)	D463V	probably damaging	Het
Pla2g4e	T	G	2: 120,186,382 (GRCm38)	H226P	possibly damaging	Het
Pou2f1	A	G	1: 165,895,006 (GRCm38)	F337L	probably damaging	Het
Ptcd1	G	T	5: 145,159,506 (GRCm38)	A259E	probably benign	Het
Ptov1	T	C	7: 44,865,576 (GRCm38)	M204V	probably benign	Het
Rasal2	A	G	1: 157,175,832 (GRCm38)	F419S	possibly damaging	Het
Rbbp8nl	A	G	2: 180,280,971 (GRCm38)	S210P	probably benign	Het
Rgmb	C	A	17: 15,807,626 (GRCm38)	R277L	probably benign	Het
Snx2	A	G	18: 53,176,444 (GRCm38)	E22G	probably benign	Het
Snx30	A	T	4: 59,885,022 (GRCm38)	R221*	probably null	Het
Tmem143	C	T	7: 45,906,952 (GRCm38)	T97I	probably damaging	Het
Ttn	A	C	2: 76,814,647 (GRCm38)	F12955V	probably damaging	Het
Ubr2	C	T	17: 46,945,045 (GRCm38)		probably null	Het
Vmn1r203	T	A	13: 22,524,682 (GRCm38)	M211K	probably damaging	Het
Vmn2r121	G	A	X: 124,128,584 (GRCm38)	P580S	probably benign	Het
Zfp804b	A	T	5: 6,771,481 (GRCm38)	D491E	probably damaging	Het

Other mutations in 9530053A07Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:9530053A07Rik	APN	7	28,164,528 (GRCm38)	missense	probably damaging	1.00
IGL00757:9530053A07Rik	APN	7	28,154,445 (GRCm38)	missense	probably damaging	1.00
IGL01015:9530053A07Rik	APN	7	28,155,318 (GRCm38)	missense	probably damaging	1.00
IGL01079:9530053A07Rik	APN	7	28,139,778 (GRCm38)	missense	probably damaging	0.99
IGL01343:9530053A07Rik	APN	7	28,150,702 (GRCm38)	missense	probably benign	0.19
IGL01420:9530053A07Rik	APN	7	28,140,133 (GRCm38)	missense	probably benign	0.28
IGL01604:9530053A07Rik	APN	7	28,155,324 (GRCm38)	missense	probably benign	0.11
IGL01666:9530053A07Rik	APN	7	28,153,292 (GRCm38)	missense	probably damaging	1.00
IGL02002:9530053A07Rik	APN	7	28,152,796 (GRCm38)	missense	probably damaging	1.00
IGL02036:9530053A07Rik	APN	7	28,137,525 (GRCm38)	missense	possibly damaging	0.82
IGL02126:9530053A07Rik	APN	7	28,139,856 (GRCm38)	missense	probably damaging	1.00
IGL02150:9530053A07Rik	APN	7	28,146,779 (GRCm38)	nonsense	probably null
IGL02219:9530053A07Rik	APN	7	28,154,635 (GRCm38)	missense	probably damaging	1.00
IGL02563:9530053A07Rik	APN	7	28,157,892 (GRCm38)	missense	probably benign
IGL02804:9530053A07Rik	APN	7	28,153,370 (GRCm38)	missense	probably benign	0.00
IGL02830:9530053A07Rik	APN	7	28,162,923 (GRCm38)	missense	probably damaging	1.00
IGL02943:9530053A07Rik	APN	7	28,147,188 (GRCm38)	missense	probably damaging	1.00
IGL02977:9530053A07Rik	APN	7	28,164,372 (GRCm38)	missense	possibly damaging	0.83
IGL03231:9530053A07Rik	APN	7	28,153,722 (GRCm38)	missense	possibly damaging	0.95
IGL03304:9530053A07Rik	APN	7	28,142,242 (GRCm38)	missense	probably damaging	0.99
herz	UTSW	7	28,153,839 (GRCm38)	missense	possibly damaging	0.72
pulse	UTSW	7	28,153,749 (GRCm38)	missense	probably damaging	1.00
Sinusoidal	UTSW	7	28,140,130 (GRCm38)	missense	probably damaging	1.00
PIT4378001:9530053A07Rik	UTSW	7	28,154,464 (GRCm38)	missense	possibly damaging	0.61
R0023:9530053A07Rik	UTSW	7	28,153,412 (GRCm38)	missense	probably benign	0.00
R0131:9530053A07Rik	UTSW	7	28,137,615 (GRCm38)	missense	probably damaging	1.00
R0131:9530053A07Rik	UTSW	7	28,137,615 (GRCm38)	missense	probably damaging	1.00
R0132:9530053A07Rik	UTSW	7	28,137,615 (GRCm38)	missense	probably damaging	1.00
R0158:9530053A07Rik	UTSW	7	28,155,492 (GRCm38)	missense	probably damaging	1.00
R0230:9530053A07Rik	UTSW	7	28,156,825 (GRCm38)	missense	probably damaging	1.00
R0310:9530053A07Rik	UTSW	7	28,142,274 (GRCm38)	missense	probably benign	0.04
R0448:9530053A07Rik	UTSW	7	28,140,235 (GRCm38)	missense	probably benign	0.03
R0462:9530053A07Rik	UTSW	7	28,137,340 (GRCm38)	missense	probably damaging	1.00
R0481:9530053A07Rik	UTSW	7	28,153,749 (GRCm38)	missense	probably damaging	1.00
R0497:9530053A07Rik	UTSW	7	28,147,465 (GRCm38)	missense	probably damaging	1.00
R0556:9530053A07Rik	UTSW	7	28,159,378 (GRCm38)	missense	probably benign
R0562:9530053A07Rik	UTSW	7	28,162,690 (GRCm38)	missense	probably benign	0.30
R0586:9530053A07Rik	UTSW	7	28,137,091 (GRCm38)	missense	probably damaging	0.99
R0924:9530053A07Rik	UTSW	7	28,140,130 (GRCm38)	missense	probably damaging	1.00
R0930:9530053A07Rik	UTSW	7	28,140,130 (GRCm38)	missense	probably damaging	1.00
R1103:9530053A07Rik	UTSW	7	28,154,520 (GRCm38)	missense	probably damaging	1.00
R1213:9530053A07Rik	UTSW	7	28,157,673 (GRCm38)	missense	probably damaging	1.00
R1292:9530053A07Rik	UTSW	7	28,142,794 (GRCm38)	splice site	probably benign
R1368:9530053A07Rik	UTSW	7	28,159,478 (GRCm38)	missense	possibly damaging	0.89
R1451:9530053A07Rik	UTSW	7	28,137,157 (GRCm38)	missense	probably damaging	1.00
R1477:9530053A07Rik	UTSW	7	28,157,093 (GRCm38)	missense	probably benign	0.01
R1538:9530053A07Rik	UTSW	7	28,155,492 (GRCm38)	missense	probably damaging	1.00
R1655:9530053A07Rik	UTSW	7	28,147,110 (GRCm38)	missense	probably damaging	0.98
R1697:9530053A07Rik	UTSW	7	28,154,347 (GRCm38)	missense	probably damaging	1.00
R1741:9530053A07Rik	UTSW	7	28,157,854 (GRCm38)	missense	probably damaging	0.98
R1796:9530053A07Rik	UTSW	7	28,155,372 (GRCm38)	missense	probably damaging	1.00
R1853:9530053A07Rik	UTSW	7	28,155,546 (GRCm38)	nonsense	probably null
R1861:9530053A07Rik	UTSW	7	28,154,732 (GRCm38)	missense	probably damaging	1.00
R1909:9530053A07Rik	UTSW	7	28,144,348 (GRCm38)	missense	possibly damaging	0.52
R1971:9530053A07Rik	UTSW	7	28,131,512 (GRCm38)	missense	possibly damaging	0.90
R1990:9530053A07Rik	UTSW	7	28,154,360 (GRCm38)	missense	probably damaging	0.98
R2020:9530053A07Rik	UTSW	7	28,155,594 (GRCm38)	missense	probably benign
R2084:9530053A07Rik	UTSW	7	28,157,535 (GRCm38)	missense	probably damaging	1.00
R2125:9530053A07Rik	UTSW	7	28,158,022 (GRCm38)	missense	probably benign	0.00
R2132:9530053A07Rik	UTSW	7	28,155,474 (GRCm38)	missense	probably damaging	1.00
R2513:9530053A07Rik	UTSW	7	28,131,635 (GRCm38)	missense	probably damaging	0.99
R2913:9530053A07Rik	UTSW	7	28,164,307 (GRCm38)	missense	probably damaging	1.00
R3150:9530053A07Rik	UTSW	7	28,154,195 (GRCm38)	missense	probably benign	0.21
R3499:9530053A07Rik	UTSW	7	28,154,555 (GRCm38)	missense	probably benign	0.42
R3702:9530053A07Rik	UTSW	7	28,157,778 (GRCm38)	missense	probably damaging	1.00
R3881:9530053A07Rik	UTSW	7	28,140,038 (GRCm38)	nonsense	probably null
R3938:9530053A07Rik	UTSW	7	28,154,294 (GRCm38)	missense	probably damaging	1.00
R4050:9530053A07Rik	UTSW	7	28,152,985 (GRCm38)	missense	possibly damaging	0.55
R4152:9530053A07Rik	UTSW	7	28,156,897 (GRCm38)	missense	possibly damaging	0.47
R4168:9530053A07Rik	UTSW	7	28,137,109 (GRCm38)	missense	probably benign	0.05
R4235:9530053A07Rik	UTSW	7	28,156,648 (GRCm38)	missense	probably damaging	0.99
R4241:9530053A07Rik	UTSW	7	28,154,335 (GRCm38)	missense	probably damaging	1.00
R4363:9530053A07Rik	UTSW	7	28,146,906 (GRCm38)	missense	probably damaging	1.00
R4463:9530053A07Rik	UTSW	7	28,150,719 (GRCm38)	missense	probably benign
R4841:9530053A07Rik	UTSW	7	28,150,722 (GRCm38)	missense	probably damaging	1.00
R4842:9530053A07Rik	UTSW	7	28,150,722 (GRCm38)	missense	probably damaging	1.00
R4876:9530053A07Rik	UTSW	7	28,142,800 (GRCm38)	intron	probably benign
R4905:9530053A07Rik	UTSW	7	28,156,983 (GRCm38)	missense	possibly damaging	0.93
R4997:9530053A07Rik	UTSW	7	28,143,924 (GRCm38)	missense	possibly damaging	0.77
R5091:9530053A07Rik	UTSW	7	28,156,958 (GRCm38)	missense	probably benign	0.44
R5159:9530053A07Rik	UTSW	7	28,153,308 (GRCm38)	missense	probably benign	0.09
R5326:9530053A07Rik	UTSW	7	28,155,489 (GRCm38)	missense	probably damaging	0.98
R5396:9530053A07Rik	UTSW	7	28,140,183 (GRCm38)	missense	probably benign
R5441:9530053A07Rik	UTSW	7	28,156,914 (GRCm38)	missense	probably damaging	1.00
R5480:9530053A07Rik	UTSW	7	28,157,999 (GRCm38)	nonsense	probably null
R5542:9530053A07Rik	UTSW	7	28,155,489 (GRCm38)	missense	probably damaging	0.98
R5571:9530053A07Rik	UTSW	7	28,156,569 (GRCm38)	missense	probably damaging	0.99
R5613:9530053A07Rik	UTSW	7	28,142,878 (GRCm38)	intron	probably benign
R5637:9530053A07Rik	UTSW	7	28,152,852 (GRCm38)	missense	probably benign	0.00
R5766:9530053A07Rik	UTSW	7	28,137,329 (GRCm38)	nonsense	probably null
R6174:9530053A07Rik	UTSW	7	28,139,959 (GRCm38)	missense	probably damaging	0.96
R6233:9530053A07Rik	UTSW	7	28,131,460 (GRCm38)	missense	probably damaging	0.99
R6250:9530053A07Rik	UTSW	7	28,150,714 (GRCm38)	missense	probably damaging	1.00
R6379:9530053A07Rik	UTSW	7	28,157,592 (GRCm38)	missense	probably damaging	1.00
R6442:9530053A07Rik	UTSW	7	28,144,186 (GRCm38)	missense	possibly damaging	0.88
R6478:9530053A07Rik	UTSW	7	28,155,373 (GRCm38)	missense	probably damaging	1.00
R6699:9530053A07Rik	UTSW	7	28,144,368 (GRCm38)	missense	probably damaging	1.00
R6852:9530053A07Rik	UTSW	7	28,147,135 (GRCm38)	missense	probably damaging	1.00
R6883:9530053A07Rik	UTSW	7	28,152,835 (GRCm38)	missense	possibly damaging	0.89
R6902:9530053A07Rik	UTSW	7	28,137,213 (GRCm38)	missense	probably damaging	1.00
R6903:9530053A07Rik	UTSW	7	28,137,213 (GRCm38)	missense	probably damaging	1.00
R6904:9530053A07Rik	UTSW	7	28,137,213 (GRCm38)	missense	probably damaging	1.00
R6992:9530053A07Rik	UTSW	7	28,140,183 (GRCm38)	missense	probably benign	0.04
R7023:9530053A07Rik	UTSW	7	28,140,038 (GRCm38)	nonsense	probably null
R7039:9530053A07Rik	UTSW	7	28,140,148 (GRCm38)	missense	possibly damaging	0.80
R7171:9530053A07Rik	UTSW	7	28,154,519 (GRCm38)	nonsense	probably null
R7282:9530053A07Rik	UTSW	7	28,144,408 (GRCm38)	missense	probably benign	0.02
R7291:9530053A07Rik	UTSW	7	28,140,220 (GRCm38)	missense	probably benign
R7344:9530053A07Rik	UTSW	7	28,152,760 (GRCm38)	missense	possibly damaging	0.46
R7344:9530053A07Rik	UTSW	7	28,140,279 (GRCm38)	missense	possibly damaging	0.79
R7392:9530053A07Rik	UTSW	7	28,164,372 (GRCm38)	missense	possibly damaging	0.83
R7531:9530053A07Rik	UTSW	7	28,140,231 (GRCm38)	missense	probably benign
R7541:9530053A07Rik	UTSW	7	28,144,256 (GRCm38)	nonsense	probably null
R7577:9530053A07Rik	UTSW	7	28,154,423 (GRCm38)	missense	possibly damaging	0.65
R7594:9530053A07Rik	UTSW	7	28,131,460 (GRCm38)	missense	probably damaging	0.99
R7647:9530053A07Rik	UTSW	7	28,140,045 (GRCm38)	missense	probably benign	0.00
R7718:9530053A07Rik	UTSW	7	28,147,201 (GRCm38)	missense	probably damaging	1.00
R7733:9530053A07Rik	UTSW	7	28,139,965 (GRCm38)	missense	probably damaging	1.00
R7737:9530053A07Rik	UTSW	7	28,157,073 (GRCm38)	missense	probably damaging	1.00
R7908:9530053A07Rik	UTSW	7	28,147,496 (GRCm38)	missense	probably benign	0.12
R8013:9530053A07Rik	UTSW	7	28,137,541 (GRCm38)	missense	probably benign	0.14
R8014:9530053A07Rik	UTSW	7	28,137,541 (GRCm38)	missense	probably benign	0.14
R8151:9530053A07Rik	UTSW	7	28,153,341 (GRCm38)	missense	possibly damaging	0.95
R8175:9530053A07Rik	UTSW	7	28,164,448 (GRCm38)	nonsense	probably null
R8254:9530053A07Rik	UTSW	7	28,147,349 (GRCm38)	missense	possibly damaging	0.63
R8345:9530053A07Rik	UTSW	7	28,155,360 (GRCm38)	missense	probably damaging	1.00
R8414:9530053A07Rik	UTSW	7	28,142,733 (GRCm38)	missense	probably damaging	1.00
R8419:9530053A07Rik	UTSW	7	28,143,921 (GRCm38)	missense	probably damaging	1.00
R8496:9530053A07Rik	UTSW	7	28,143,952 (GRCm38)	missense	possibly damaging	0.81
R8691:9530053A07Rik	UTSW	7	28,153,839 (GRCm38)	missense	possibly damaging	0.72
R8785:9530053A07Rik	UTSW	7	28,154,707 (GRCm38)	missense	probably damaging	1.00
R8863:9530053A07Rik	UTSW	7	28,131,581 (GRCm38)	missense	probably damaging	1.00
R8926:9530053A07Rik	UTSW	7	28,154,444 (GRCm38)	missense	probably damaging	1.00
R8950:9530053A07Rik	UTSW	7	28,164,326 (GRCm38)	missense	probably benign	0.32
R9014:9530053A07Rik	UTSW	7	28,155,451 (GRCm38)	missense	probably damaging	1.00
R9045:9530053A07Rik	UTSW	7	28,154,431 (GRCm38)	missense	probably damaging	1.00
R9115:9530053A07Rik	UTSW	7	28,154,329 (GRCm38)	missense	possibly damaging	0.74
R9233:9530053A07Rik	UTSW	7	28,140,094 (GRCm38)	missense	possibly damaging	0.83
R9330:9530053A07Rik	UTSW	7	28,156,985 (GRCm38)	missense	probably benign	0.02
R9426:9530053A07Rik	UTSW	7	28,143,856 (GRCm38)	missense	possibly damaging	0.92
R9477:9530053A07Rik	UTSW	7	28,152,840 (GRCm38)	missense	probably damaging	1.00
R9502:9530053A07Rik	UTSW	7	28,137,466 (GRCm38)	missense	probably benign	0.09
R9505:9530053A07Rik	UTSW	7	28,142,484 (GRCm38)	nonsense	probably null
R9601:9530053A07Rik	UTSW	7	28,154,380 (GRCm38)	missense	possibly damaging	0.78
R9630:9530053A07Rik	UTSW	7	28,137,199 (GRCm38)	missense	probably damaging	1.00
R9632:9530053A07Rik	UTSW	7	28,142,301 (GRCm38)	missense	probably benign
R9673:9530053A07Rik	UTSW	7	28,156,619 (GRCm38)	missense	probably benign	0.25
R9735:9530053A07Rik	UTSW	7	28,157,010 (GRCm38)	missense	probably damaging	1.00
Z1176:9530053A07Rik	UTSW	7	28,154,762 (GRCm38)	missense	probably benign	0.03
Z1176:9530053A07Rik	UTSW	7	28,142,386 (GRCm38)	missense	probably benign	0.06
Z1177:9530053A07Rik	UTSW	7	28,139,898 (GRCm38)	missense	probably benign	0.25
Z1186:9530053A07Rik	UTSW	7	28,156,986 (GRCm38)	missense	probably benign	0.01
Z1186:9530053A07Rik	UTSW	7	28,146,705 (GRCm38)	missense	probably benign	0.00
Z1186:9530053A07Rik	UTSW	7	28,131,572 (GRCm38)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGCAGCAGCTCAAGAATATTGTC -3'
(R):5'- CAACGCTGGCCTTCTTAGAG -3'

Sequencing Primer
(F):5'- AGCAGCTCAAGAATATTGTCTCCTC -3'
(R):5'- GAGTCTTAGGTCCCACTAATCATAC -3'

Posted On

2015-07-21