Incidental Mutation 'R4460:Klhl26'
ID330108
Institutional Source Beutler Lab
Gene Symbol Klhl26
Ensembl Gene ENSMUSG00000055707
Gene Namekelch-like 26
Synonyms
MMRRC Submission 041719-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4460 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70450219-70476968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70451544 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 538 (Y538C)
Ref Sequence ENSEMBL: ENSMUSP00000147385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066597] [ENSMUST00000166976] [ENSMUST00000209415] [ENSMUST00000209567] [ENSMUST00000210250]
Predicted Effect probably damaging
Transcript: ENSMUST00000066597
AA Change: Y572C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069077
Gene: ENSMUSG00000055707
AA Change: Y572C

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
BTB 54 151 1.56e-26 SMART
BACK 156 257 1.62e-28 SMART
Blast:Kelch 301 352 4e-27 BLAST
Kelch 353 404 1.44e0 SMART
Kelch 405 451 2.86e-4 SMART
Kelch 452 499 1.21e-2 SMART
Kelch 500 550 4.27e-3 SMART
Kelch 551 597 4.93e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166976
AA Change: Y511C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129607
Gene: ENSMUSG00000055707
AA Change: Y511C

DomainStartEndE-ValueType
Pfam:BTB 19 89 1.7e-13 PFAM
BACK 95 196 1.62e-28 SMART
Blast:Kelch 240 291 4e-27 BLAST
Kelch 292 343 1.44e0 SMART
Kelch 344 390 2.86e-4 SMART
Kelch 391 438 1.21e-2 SMART
Kelch 439 489 4.27e-3 SMART
Kelch 490 536 4.93e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209415
Predicted Effect probably damaging
Transcript: ENSMUST00000209567
AA Change: Y491C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000210250
AA Change: Y538C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9440 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,152,856 T1268I probably benign Het
A830010M20Rik A G 5: 107,503,765 T687A possibly damaging Het
C030048H21Rik A G 2: 26,255,863 probably null Het
Cav1 A G 6: 17,306,472 D8G probably damaging Het
Celf6 G A 9: 59,603,044 R103H probably damaging Het
Ctr9 A G 7: 111,046,894 I698V probably benign Het
Cts6 G C 13: 61,195,458 I316M probably benign Het
Dnajc13 C A 9: 104,181,063 R1496L probably damaging Het
Dscam A G 16: 96,610,319 Y1786H probably damaging Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ltk A G 2: 119,755,613 probably null Het
Med20 T C 17: 47,618,917 V93A probably benign Het
Mmp9 G T 2: 164,949,038 K115N probably damaging Het
Mroh5 A T 15: 73,791,796 D339E probably damaging Het
Muc1 A T 3: 89,231,563 D493V probably damaging Het
Mx1 G T 16: 97,454,081 S113R probably damaging Het
Nlrp9c T A 7: 26,378,098 H698L probably damaging Het
Nol9 T G 4: 152,057,836 L641R probably damaging Het
Park2 A T 17: 12,061,646 D463V probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Ptcd1 G T 5: 145,159,506 A259E probably benign Het
Ptov1 T C 7: 44,865,576 M204V probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rbbp8nl A G 2: 180,280,971 S210P probably benign Het
Rgmb C A 17: 15,807,626 R277L probably benign Het
Snx2 A G 18: 53,176,444 E22G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tmem143 C T 7: 45,906,952 T97I probably damaging Het
Ttn A C 2: 76,814,647 F12955V probably damaging Het
Ubr2 C T 17: 46,945,045 probably null Het
Vmn1r203 T A 13: 22,524,682 M211K probably damaging Het
Vmn2r121 G A X: 124,128,584 P580S probably benign Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Klhl26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Klhl26 APN 8 70451883 missense probably damaging 1.00
IGL02508:Klhl26 APN 8 70452731 missense probably damaging 1.00
IGL03089:Klhl26 APN 8 70455633 missense probably benign 0.05
IGL03144:Klhl26 APN 8 70452564 missense probably damaging 1.00
R0365:Klhl26 UTSW 8 70451829 missense probably damaging 1.00
R0408:Klhl26 UTSW 8 70452480 missense probably damaging 1.00
R0494:Klhl26 UTSW 8 70451601 missense probably damaging 1.00
R1889:Klhl26 UTSW 8 70451733 missense probably damaging 0.99
R1940:Klhl26 UTSW 8 70452261 missense probably damaging 1.00
R3902:Klhl26 UTSW 8 70452366 missense probably damaging 0.98
R4458:Klhl26 UTSW 8 70452692 missense possibly damaging 0.89
R4459:Klhl26 UTSW 8 70451544 missense probably damaging 1.00
R4461:Klhl26 UTSW 8 70451544 missense probably damaging 1.00
R5135:Klhl26 UTSW 8 70452718 missense probably benign 0.19
R5334:Klhl26 UTSW 8 70452318 missense probably damaging 1.00
R5342:Klhl26 UTSW 8 70455565 missense probably damaging 1.00
R5711:Klhl26 UTSW 8 70452324 missense probably damaging 0.98
R5724:Klhl26 UTSW 8 70451754 missense probably damaging 1.00
R5965:Klhl26 UTSW 8 70452731 missense probably damaging 1.00
R7319:Klhl26 UTSW 8 70452942 missense probably damaging 0.99
R7390:Klhl26 UTSW 8 70452849 missense probably damaging 0.98
Z1088:Klhl26 UTSW 8 70451799 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGCACCTAAACCTTGGGG -3'
(R):5'- CTGCAGTGCTATGATCCAGC -3'

Sequencing Primer
(F):5'- GGGACCAGATCTCTCTCTCTG -3'
(R):5'- TGCTATGATCCAGCAGCCGAC -3'
Posted On2015-07-21