Incidental Mutation 'R4460:Celf6'
ID330109
Institutional Source Beutler Lab
Gene Symbol Celf6
Ensembl Gene ENSMUSG00000032297
Gene NameCUGBP, Elav-like family member 6
Synonyms6330569O16Rik, Brunol6
MMRRC Submission 041719-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4460 (G1)
Quality Score107
Status Not validated
Chromosome9
Chromosomal Location59577917-59607292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59603044 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 103 (R103H)
Ref Sequence ENSEMBL: ENSMUSP00000113196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034840] [ENSMUST00000118164] [ENSMUST00000118549] [ENSMUST00000121266] [ENSMUST00000129357] [ENSMUST00000143916]
Predicted Effect probably damaging
Transcript: ENSMUST00000034840
AA Change: R218H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034840
Gene: ENSMUSG00000032297
AA Change: R218H

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
RRM 47 123 2.16e-19 SMART
RRM 135 210 1.05e-17 SMART
low complexity region 252 294 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
RRM 376 449 7.35e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118164
AA Change: R103H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112403
Gene: ENSMUSG00000032297
AA Change: R103H

DomainStartEndE-ValueType
RRM 20 95 1.05e-17 SMART
low complexity region 137 179 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 225 238 N/A INTRINSIC
RRM 260 333 7.35e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118549
AA Change: R218H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112755
Gene: ENSMUSG00000032297
AA Change: R218H

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
RRM 47 123 2.16e-19 SMART
RRM 135 210 1.05e-17 SMART
low complexity region 252 294 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
low complexity region 356 375 N/A INTRINSIC
RRM 397 470 7.35e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121266
AA Change: R103H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113196
Gene: ENSMUSG00000032297
AA Change: R103H

DomainStartEndE-ValueType
RRM 20 95 1.05e-17 SMART
low complexity region 137 179 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 225 239 N/A INTRINSIC
RRM 261 334 7.35e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129357
SMART Domains Protein: ENSMUSP00000122167
Gene: ENSMUSG00000032297

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
RRM 47 121 1e-14 SMART
low complexity region 138 149 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129728
Predicted Effect probably benign
Transcript: ENSMUST00000143916
SMART Domains Protein: ENSMUSP00000118556
Gene: ENSMUSG00000032297

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
RRM 47 123 2.16e-19 SMART
Pfam:RRM_1 136 177 1.5e-7 PFAM
Pfam:RRM_6 136 177 3.7e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146503
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased ultrasonic vocalization, decreased brain serotonin levels, and selective behavioral deficits including an abnormal response to novel odor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,152,856 T1268I probably benign Het
A830010M20Rik A G 5: 107,503,765 T687A possibly damaging Het
C030048H21Rik A G 2: 26,255,863 probably null Het
Cav1 A G 6: 17,306,472 D8G probably damaging Het
Ctr9 A G 7: 111,046,894 I698V probably benign Het
Cts6 G C 13: 61,195,458 I316M probably benign Het
Dnajc13 C A 9: 104,181,063 R1496L probably damaging Het
Dscam A G 16: 96,610,319 Y1786H probably damaging Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Ltk A G 2: 119,755,613 probably null Het
Med20 T C 17: 47,618,917 V93A probably benign Het
Mmp9 G T 2: 164,949,038 K115N probably damaging Het
Mroh5 A T 15: 73,791,796 D339E probably damaging Het
Muc1 A T 3: 89,231,563 D493V probably damaging Het
Mx1 G T 16: 97,454,081 S113R probably damaging Het
Nlrp9c T A 7: 26,378,098 H698L probably damaging Het
Nol9 T G 4: 152,057,836 L641R probably damaging Het
Park2 A T 17: 12,061,646 D463V probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Ptcd1 G T 5: 145,159,506 A259E probably benign Het
Ptov1 T C 7: 44,865,576 M204V probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rbbp8nl A G 2: 180,280,971 S210P probably benign Het
Rgmb C A 17: 15,807,626 R277L probably benign Het
Snx2 A G 18: 53,176,444 E22G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tmem143 C T 7: 45,906,952 T97I probably damaging Het
Ttn A C 2: 76,814,647 F12955V probably damaging Het
Ubr2 C T 17: 46,945,045 probably null Het
Vmn1r203 T A 13: 22,524,682 M211K probably damaging Het
Vmn2r121 G A X: 124,128,584 P580S probably benign Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Celf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Celf6 APN 9 59603525 missense probably damaging 0.98
IGL03172:Celf6 APN 9 59582282 missense probably damaging 1.00
R0119:Celf6 UTSW 9 59602878 missense probably benign 0.00
R0299:Celf6 UTSW 9 59602878 missense probably benign 0.00
R0499:Celf6 UTSW 9 59602878 missense probably benign 0.00
R1188:Celf6 UTSW 9 59590678 missense probably benign 0.34
R1543:Celf6 UTSW 9 59603877 splice site probably benign
R2198:Celf6 UTSW 9 59603339 missense possibly damaging 0.95
R2207:Celf6 UTSW 9 59604327 missense possibly damaging 0.93
R6908:Celf6 UTSW 9 59603823 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTTGTGAAATTCGGAAGTCAAGGG -3'
(R):5'- CAGAGGCTAGCAACTGCCAC -3'

Sequencing Primer
(F):5'- CATCCAGGGACTACACGGTAG -3'
(R):5'- TAGCAACTGCCACTGGGTC -3'
Posted On2015-07-21