Mutagenetix > Incidental Mutation

Incidental Mutation 'R4460:Itga2'

330114

Institutional Source

Beutler Lab

Gene Symbol

Itga2

Ensembl Gene

ENSMUSG00000015533

Gene Name

integrin alpha 2

Synonyms

DX5, VLA-2 receptor, alpha 2 subunit, CD49B

MMRRC Submission

041719-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4460 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114969617-115068636 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 114980019 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Histidine at position 1061 (D1061H)

Ref Sequence

ENSEMBL: ENSMUSP00000053891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056117]

AlphaFold

Q62469

Predicted Effect

probably damaging
Transcript: ENSMUST00000056117
AA Change: D1061H

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000053891
Gene: ENSMUSG00000015533
AA Change: D1061H

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Int_alpha	41	96	4.91e-4	SMART
VWA	169	359	2.42e-39	SMART
Blast:VWA	364	424	4e-26	BLAST
Int_alpha	430	481	2.59e-3	SMART
Int_alpha	484	541	3.5e-9	SMART
Int_alpha	547	602	3.11e-15	SMART
Int_alpha	611	669	2.52e-1	SMART
low complexity region	890	910	N/A	INTRINSIC
transmembrane domain	1129	1151	N/A	INTRINSIC
Pfam:Integrin_alpha	1152	1166	9e-7	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of a transmembrane receptor for collagens and related proteins. The encoded protein forms a heterodimer with a beta subunit and mediates the adhesion of platelets and other cell types to the extracellular matrix. Loss of the encoded protein is associated with bleeding disorder platelet-type 9. Antibodies against this protein are found in several immune disorders, including neonatal alloimmune thrombocytopenia. This gene is located adjacent to a related alpha subunit gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for targeted null mutations were viable, fertile, showed no overt anatomical defects, and exhibited no bleeding anomalies. Platelet, primary fibroblast and keratinocytes from homozygous mutant mice show less efficient adhesion to collagens in vitro. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Btbd8	A	G	5: 107,651,631 (GRCm39)	T687A	possibly damaging	Het
C030048H21Rik	A	G	2: 26,145,875 (GRCm39)		probably null	Het
Cav1	A	G	6: 17,306,471 (GRCm39)	D8G	probably damaging	Het
Celf6	G	A	9: 59,510,327 (GRCm39)	R103H	probably damaging	Het
Ctr9	A	G	7: 110,646,101 (GRCm39)	I698V	probably benign	Het
Cts6	G	C	13: 61,343,272 (GRCm39)	I316M	probably benign	Het
Dnajc13	C	A	9: 104,058,262 (GRCm39)	R1496L	probably damaging	Het
Dscam	A	G	16: 96,411,519 (GRCm39)	Y1786H	probably damaging	Het
Fcgbpl1	C	T	7: 27,852,281 (GRCm39)	T1268I	probably benign	Het
Kirrel1	C	T	3: 86,996,458 (GRCm39)	M380I	probably null	Het
Klhl26	T	C	8: 70,904,194 (GRCm39)	Y538C	probably damaging	Het
Ltk	A	G	2: 119,586,094 (GRCm39)		probably null	Het
Med20	T	C	17: 47,929,842 (GRCm39)	V93A	probably benign	Het
Mmp9	G	T	2: 164,790,958 (GRCm39)	K115N	probably damaging	Het
Mroh5	A	T	15: 73,663,645 (GRCm39)	D339E	probably damaging	Het
Muc1	A	T	3: 89,138,870 (GRCm39)	D493V	probably damaging	Het
Mx1	G	T	16: 97,255,281 (GRCm39)	S113R	probably damaging	Het
Nlrp9c	T	A	7: 26,077,523 (GRCm39)	H698L	probably damaging	Het
Nol9	T	G	4: 152,142,293 (GRCm39)	L641R	probably damaging	Het
Pla2g4e	T	G	2: 120,016,863 (GRCm39)	H226P	possibly damaging	Het
Pou2f1	A	G	1: 165,722,575 (GRCm39)	F337L	probably damaging	Het
Prkn	A	T	17: 12,280,533 (GRCm39)	D463V	probably damaging	Het
Ptcd1	G	T	5: 145,096,316 (GRCm39)	A259E	probably benign	Het
Ptov1	T	C	7: 44,515,000 (GRCm39)	M204V	probably benign	Het
Rasal2	A	G	1: 157,003,402 (GRCm39)	F419S	possibly damaging	Het
Rbbp8nl	A	G	2: 179,922,764 (GRCm39)	S210P	probably benign	Het
Rgmb	C	A	17: 16,027,888 (GRCm39)	R277L	probably benign	Het
Snx2	A	G	18: 53,309,516 (GRCm39)	E22G	probably benign	Het
Snx30	A	T	4: 59,885,022 (GRCm39)	R221*	probably null	Het
Tmem143	C	T	7: 45,556,376 (GRCm39)	T97I	probably damaging	Het
Ttn	A	C	2: 76,644,991 (GRCm39)	F12955V	probably damaging	Het
Ubr2	C	T	17: 47,255,971 (GRCm39)		probably null	Het
Vmn1r203	T	A	13: 22,708,852 (GRCm39)	M211K	probably damaging	Het
Vmn2r121	G	A	X: 123,038,281 (GRCm39)	P580S	probably benign	Het
Zfp804b	A	T	5: 6,821,481 (GRCm39)	D491E	probably damaging	Het

Other mutations in Itga2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00809:Itga2	APN	13	115,014,161 (GRCm39)	missense	probably damaging	0.99
IGL01481:Itga2	APN	13	114,996,168 (GRCm39)	missense	possibly damaging	0.63
IGL01666:Itga2	APN	13	114,973,627 (GRCm39)	critical splice donor site	probably null
IGL01730:Itga2	APN	13	114,990,947 (GRCm39)	splice site	probably benign
IGL01965:Itga2	APN	13	114,984,600 (GRCm39)	splice site	probably benign
IGL01987:Itga2	APN	13	114,984,482 (GRCm39)	nonsense	probably null
IGL02334:Itga2	APN	13	115,001,845 (GRCm39)	critical splice donor site	probably null
IGL02381:Itga2	APN	13	114,993,258 (GRCm39)	missense	probably damaging	1.00
IGL02562:Itga2	APN	13	114,973,106 (GRCm39)	unclassified	probably benign
IGL03191:Itga2	APN	13	114,973,020 (GRCm39)	unclassified	probably benign
IGL03209:Itga2	APN	13	115,017,168 (GRCm39)	missense	probably damaging	1.00
P0007:Itga2	UTSW	13	115,002,735 (GRCm39)	missense	probably damaging	1.00
R0023:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0023:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0025:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0029:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0062:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0062:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0149:Itga2	UTSW	13	114,973,115 (GRCm39)	unclassified	probably benign
R0152:Itga2	UTSW	13	115,002,850 (GRCm39)	missense	probably benign	0.06
R0496:Itga2	UTSW	13	114,990,435 (GRCm39)	missense	probably benign	0.00
R0502:Itga2	UTSW	13	114,982,392 (GRCm39)	missense	probably benign	0.15
R0599:Itga2	UTSW	13	114,993,186 (GRCm39)	splice site	probably benign
R0688:Itga2	UTSW	13	114,976,090 (GRCm39)	missense	probably benign	0.00
R0704:Itga2	UTSW	13	114,998,911 (GRCm39)	missense	possibly damaging	0.91
R0760:Itga2	UTSW	13	114,996,168 (GRCm39)	missense	possibly damaging	0.63
R0811:Itga2	UTSW	13	115,007,150 (GRCm39)	missense	possibly damaging	0.92
R0812:Itga2	UTSW	13	115,007,150 (GRCm39)	missense	possibly damaging	0.92
R0836:Itga2	UTSW	13	114,993,215 (GRCm39)	missense	probably damaging	0.99
R1196:Itga2	UTSW	13	115,002,691 (GRCm39)	critical splice donor site	probably null
R1546:Itga2	UTSW	13	114,985,956 (GRCm39)	missense	possibly damaging	0.63
R1639:Itga2	UTSW	13	114,993,832 (GRCm39)	missense	probably benign	0.00
R1834:Itga2	UTSW	13	114,993,263 (GRCm39)	missense	probably damaging	1.00
R1834:Itga2	UTSW	13	114,993,262 (GRCm39)	missense	probably damaging	0.98
R2180:Itga2	UTSW	13	114,985,917 (GRCm39)	missense	possibly damaging	0.67
R2190:Itga2	UTSW	13	115,007,141 (GRCm39)	missense	probably benign	0.05
R2518:Itga2	UTSW	13	115,017,578 (GRCm39)	missense	probably damaging	1.00
R3885:Itga2	UTSW	13	115,005,835 (GRCm39)	missense	probably benign	0.35
R3962:Itga2	UTSW	13	114,976,054 (GRCm39)	missense	probably damaging	0.99
R4094:Itga2	UTSW	13	115,007,161 (GRCm39)	missense	probably benign	0.01
R4193:Itga2	UTSW	13	115,023,185 (GRCm39)	nonsense	probably null
R4290:Itga2	UTSW	13	115,002,709 (GRCm39)	missense	probably damaging	0.98
R4459:Itga2	UTSW	13	114,980,019 (GRCm39)	missense	probably damaging	0.97
R4628:Itga2	UTSW	13	115,014,229 (GRCm39)	missense	probably benign	0.03
R4655:Itga2	UTSW	13	115,009,805 (GRCm39)	missense	probably benign	0.00
R4716:Itga2	UTSW	13	114,993,909 (GRCm39)	missense	probably damaging	0.98
R4896:Itga2	UTSW	13	114,990,302 (GRCm39)	nonsense	probably null
R5093:Itga2	UTSW	13	114,992,717 (GRCm39)	missense	probably benign	0.00
R5488:Itga2	UTSW	13	114,979,971 (GRCm39)	missense	probably damaging	1.00
R5489:Itga2	UTSW	13	114,979,971 (GRCm39)	missense	probably damaging	1.00
R5743:Itga2	UTSW	13	115,021,042 (GRCm39)	missense	probably damaging	1.00
R5767:Itga2	UTSW	13	114,976,106 (GRCm39)	missense	possibly damaging	0.88
R5790:Itga2	UTSW	13	115,004,742 (GRCm39)	missense	probably benign	0.02
R5923:Itga2	UTSW	13	115,021,055 (GRCm39)	missense	probably benign	0.02
R6163:Itga2	UTSW	13	115,002,726 (GRCm39)	missense	probably damaging	1.00
R6227:Itga2	UTSW	13	114,976,097 (GRCm39)	missense	probably benign	0.30
R6278:Itga2	UTSW	13	114,982,424 (GRCm39)	missense	probably benign	0.05
R6283:Itga2	UTSW	13	115,005,786 (GRCm39)	missense	probably damaging	1.00
R6332:Itga2	UTSW	13	114,980,009 (GRCm39)	missense	probably benign
R6510:Itga2	UTSW	13	115,009,816 (GRCm39)	missense	probably damaging	1.00
R6742:Itga2	UTSW	13	114,973,061 (GRCm39)	missense	possibly damaging	0.93
R6869:Itga2	UTSW	13	115,012,073 (GRCm39)	splice site	probably null
R7073:Itga2	UTSW	13	114,996,149 (GRCm39)	missense	probably damaging	1.00
R7111:Itga2	UTSW	13	115,037,066 (GRCm39)	missense	unknown
R7236:Itga2	UTSW	13	115,014,227 (GRCm39)	missense	probably benign
R7269:Itga2	UTSW	13	115,023,225 (GRCm39)	nonsense	probably null
R7296:Itga2	UTSW	13	114,993,930 (GRCm39)	splice site	probably null
R7350:Itga2	UTSW	13	114,973,738 (GRCm39)	missense	probably damaging	0.98
R7375:Itga2	UTSW	13	115,005,753 (GRCm39)	missense	probably benign	0.06
R7501:Itga2	UTSW	13	115,012,095 (GRCm39)	missense	probably damaging	1.00
R7687:Itga2	UTSW	13	115,002,796 (GRCm39)	missense	probably damaging	1.00
R7766:Itga2	UTSW	13	114,990,427 (GRCm39)	missense	probably benign
R7810:Itga2	UTSW	13	115,002,715 (GRCm39)	missense	probably benign	0.15
R8038:Itga2	UTSW	13	114,990,291 (GRCm39)	missense	probably damaging	1.00
R8948:Itga2	UTSW	13	115,009,866 (GRCm39)	missense	probably damaging	1.00
R9132:Itga2	UTSW	13	115,014,298 (GRCm39)	nonsense	probably null
R9153:Itga2	UTSW	13	115,001,941 (GRCm39)	missense	probably benign	0.00
R9159:Itga2	UTSW	13	115,014,298 (GRCm39)	nonsense	probably null
R9651:Itga2	UTSW	13	115,020,991 (GRCm39)	missense	probably benign	0.00
R9652:Itga2	UTSW	13	115,020,991 (GRCm39)	missense	probably benign	0.00
R9653:Itga2	UTSW	13	115,020,991 (GRCm39)	missense	probably benign	0.00
Z1088:Itga2	UTSW	13	114,993,868 (GRCm39)	missense	possibly damaging	0.46
Z1177:Itga2	UTSW	13	114,990,237 (GRCm39)	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATGCTGTTTATGGCAAGGACAG -3'
(R):5'- TATCCAGGGTCCTTCCTAGC -3'

Sequencing Primer
(F):5'- TGACACTATTCATGGAGATGCCG -3'
(R):5'- AGGGTCCTTCCTAGCACTGAG -3'

Posted On

2015-07-21