Incidental Mutation 'R4460:Mroh5'
ID330116
Institutional Source Beutler Lab
Gene Symbol Mroh5
Ensembl Gene ENSMUSG00000072487
Gene Namemaestro heat-like repeat family member 5
SynonymsLOC268816, Gm628
MMRRC Submission 041719-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4460 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location73761410-73839699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73791796 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 339 (D339E)
Ref Sequence ENSEMBL: ENSMUSP00000118236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071419] [ENSMUST00000110021] [ENSMUST00000151999]
Predicted Effect probably benign
Transcript: ENSMUST00000071419
AA Change: D138E

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071366
Gene: ENSMUSG00000072487
AA Change: D138E

DomainStartEndE-ValueType
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110021
AA Change: D174E

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136698
Predicted Effect probably damaging
Transcript: ENSMUST00000151999
AA Change: D339E

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118236
Gene: ENSMUSG00000072487
AA Change: D339E

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
SCOP:d1gw5a_ 294 635 1e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,152,856 T1268I probably benign Het
A830010M20Rik A G 5: 107,503,765 T687A possibly damaging Het
C030048H21Rik A G 2: 26,255,863 probably null Het
Cav1 A G 6: 17,306,472 D8G probably damaging Het
Celf6 G A 9: 59,603,044 R103H probably damaging Het
Ctr9 A G 7: 111,046,894 I698V probably benign Het
Cts6 G C 13: 61,195,458 I316M probably benign Het
Dnajc13 C A 9: 104,181,063 R1496L probably damaging Het
Dscam A G 16: 96,610,319 Y1786H probably damaging Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Ltk A G 2: 119,755,613 probably null Het
Med20 T C 17: 47,618,917 V93A probably benign Het
Mmp9 G T 2: 164,949,038 K115N probably damaging Het
Muc1 A T 3: 89,231,563 D493V probably damaging Het
Mx1 G T 16: 97,454,081 S113R probably damaging Het
Nlrp9c T A 7: 26,378,098 H698L probably damaging Het
Nol9 T G 4: 152,057,836 L641R probably damaging Het
Park2 A T 17: 12,061,646 D463V probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Ptcd1 G T 5: 145,159,506 A259E probably benign Het
Ptov1 T C 7: 44,865,576 M204V probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rbbp8nl A G 2: 180,280,971 S210P probably benign Het
Rgmb C A 17: 15,807,626 R277L probably benign Het
Snx2 A G 18: 53,176,444 E22G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tmem143 C T 7: 45,906,952 T97I probably damaging Het
Ttn A C 2: 76,814,647 F12955V probably damaging Het
Ubr2 C T 17: 46,945,045 probably null Het
Vmn1r203 T A 13: 22,524,682 M211K probably damaging Het
Vmn2r121 G A X: 124,128,584 P580S probably benign Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Mroh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Mroh5 APN 15 73792789 splice site probably benign
IGL00466:Mroh5 APN 15 73792789 splice site probably benign
IGL02937:Mroh5 APN 15 73789978 missense probably damaging 1.00
R0102:Mroh5 UTSW 15 73819350 missense probably benign 0.07
R0321:Mroh5 UTSW 15 73790043 missense probably damaging 1.00
R0433:Mroh5 UTSW 15 73790028 missense probably benign 0.01
R0433:Mroh5 UTSW 15 73790808 missense probably damaging 1.00
R0707:Mroh5 UTSW 15 73790739 missense possibly damaging 0.48
R1666:Mroh5 UTSW 15 73787905 missense probably benign 0.43
R1668:Mroh5 UTSW 15 73787905 missense probably benign 0.43
R2139:Mroh5 UTSW 15 73790091 missense probably damaging 1.00
R2269:Mroh5 UTSW 15 73793148 missense probably benign 0.02
R4078:Mroh5 UTSW 15 73786040 missense possibly damaging 0.79
R4420:Mroh5 UTSW 15 73783074 small deletion probably benign
R4585:Mroh5 UTSW 15 73789271 missense probably benign 0.38
R5285:Mroh5 UTSW 15 73783074 small deletion probably benign
R5287:Mroh5 UTSW 15 73783074 small deletion probably benign
R5437:Mroh5 UTSW 15 73787969 missense probably benign 0.02
R5760:Mroh5 UTSW 15 73821507 missense probably damaging 0.98
R5972:Mroh5 UTSW 15 73790719 critical splice donor site probably null
R6192:Mroh5 UTSW 15 73790781 missense probably damaging 1.00
R6457:Mroh5 UTSW 15 73790842 missense probably damaging 1.00
R6477:Mroh5 UTSW 15 73790755 missense probably damaging 1.00
R6776:Mroh5 UTSW 15 73789968 critical splice donor site probably null
R6979:Mroh5 UTSW 15 73793129 missense probably benign 0.16
R7238:Mroh5 UTSW 15 73791429 critical splice acceptor site probably null
R7406:Mroh5 UTSW 15 73787734 missense probably benign 0.38
X0024:Mroh5 UTSW 15 73787721 missense probably benign 0.01
Z1088:Mroh5 UTSW 15 73788031 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGGCAACCATAATCCTAGAGTGG -3'
(R):5'- ACTCCTATCCTGAGCATGTCTG -3'

Sequencing Primer
(F):5'- CCATAATCCTAGAGTGGTTGCTATG -3'
(R):5'- CATGTCTGCCCAGAGCTG -3'
Posted On2015-07-21