Incidental Mutation 'R0047:Mark2'
ID 33013
Institutional Source Beutler Lab
Gene Symbol Mark2
Ensembl Gene ENSMUSG00000024969
Gene Name MAP/microtubule affinity regulating kinase 2
Synonyms Par-1, Emk
MMRRC Submission 038341-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.913) question?
Stock # R0047 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 19
Chromosomal Location 7252761-7319222 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to C at 7260942 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000025921] [ENSMUST00000032557] [ENSMUST00000051711] [ENSMUST00000164129] [ENSMUST00000164205] [ENSMUST00000165286] [ENSMUST00000165965] [ENSMUST00000168872] [ENSMUST00000171352] [ENSMUST00000169541] [ENSMUST00000171393] [ENSMUST00000167767] [ENSMUST00000166461]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025921
SMART Domains Protein: ENSMUSP00000025921
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 20 271 1.59e-108 SMART
UBA 292 329 7.69e-7 SMART
low complexity region 475 489 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
Pfam:KA1 697 743 2.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032557
SMART Domains Protein: ENSMUSP00000032557
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 685 731 5.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051711
SMART Domains Protein: ENSMUSP00000108969
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 508 522 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Pfam:KA1 730 776 6.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163345
SMART Domains Protein: ENSMUSP00000125944
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 58 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164129
Predicted Effect probably benign
Transcript: ENSMUST00000164205
SMART Domains Protein: ENSMUSP00000127827
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 676 722 5.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165286
SMART Domains Protein: ENSMUSP00000126468
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 670 716 6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165881
SMART Domains Protein: ENSMUSP00000126753
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 88 102 N/A INTRINSIC
low complexity region 145 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165965
SMART Domains Protein: ENSMUSP00000131684
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 508 522 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Pfam:KA1 732 776 7.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168872
SMART Domains Protein: ENSMUSP00000128560
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 661 707 5.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170768
Predicted Effect probably benign
Transcript: ENSMUST00000171721
SMART Domains Protein: ENSMUSP00000129506
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 44 295 1.59e-108 SMART
UBA 316 353 7.69e-7 SMART
low complexity region 499 513 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
Pfam:KA1 732 776 7.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168852
Predicted Effect probably benign
Transcript: ENSMUST00000171352
SMART Domains Protein: ENSMUSP00000129490
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169541
SMART Domains Protein: ENSMUSP00000128779
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
Pfam:Pkinase 53 110 1.7e-12 PFAM
Pfam:Pkinase_Tyr 53 110 7.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171393
SMART Domains Protein: ENSMUSP00000129894
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
Pfam:Pkinase 20 193 1.2e-59 PFAM
Pfam:Pkinase_Tyr 20 193 1.2e-35 PFAM
Pfam:RIO1 30 174 3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167767
SMART Domains Protein: ENSMUSP00000132482
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
PDB:3OSE|A 220 264 1e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000166461
SMART Domains Protein: ENSMUSP00000128549
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 45 59 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
Pfam:KA1 261 307 1.9e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Par-1 family of serine/threonine protein kinases. The protein is an important regulator of cell polarity in epithelial and neuronal cells, and also controls the stability of microtubules through phosphorylation and inactivation of several microtubule-associating proteins. The protein localizes to cell membranes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit proportionate dwarfism with smaller pituitaries and reduced growth hormone and prolactin secretion. Mutants develop autoimmunity and fail to breed when mated to each other. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,772,025 (GRCm39) T405A probably damaging Het
Acer1 A T 17: 57,262,624 (GRCm39) D175E possibly damaging Het
Acsf2 T C 11: 94,460,168 (GRCm39) I395V probably benign Het
Adamts9 G A 6: 92,882,287 (GRCm39) probably benign Het
Amigo3 T C 9: 107,931,857 (GRCm39) S427P probably benign Het
Ankrd35 A G 3: 96,591,379 (GRCm39) K555R probably benign Het
Arhgap35 A T 7: 16,295,917 (GRCm39) H1049Q probably benign Het
Arhgef5 G A 6: 43,242,555 (GRCm39) probably null Het
Arid4a T G 12: 71,122,193 (GRCm39) L858W probably damaging Het
Bbox1 A G 2: 110,098,647 (GRCm39) F310S probably damaging Het
Bhlhe22 T C 3: 18,109,733 (GRCm39) L261P probably damaging Het
Bltp1 T A 3: 36,962,341 (GRCm39) L481M possibly damaging Het
Bmper T A 9: 23,317,982 (GRCm39) C534S probably damaging Het
Cacna1d T G 14: 30,068,747 (GRCm39) probably benign Het
Camk2g G A 14: 20,821,136 (GRCm39) probably benign Het
Capn12 G A 7: 28,589,812 (GRCm39) probably null Het
Cdkl4 T G 17: 80,858,274 (GRCm39) N115T probably benign Het
Chchd1 T C 14: 20,754,231 (GRCm39) S48P possibly damaging Het
Chia1 G T 3: 106,022,573 (GRCm39) C49F probably damaging Het
Cnot7 A G 8: 40,948,962 (GRCm39) probably benign Het
Crh T C 3: 19,748,201 (GRCm39) E147G probably damaging Het
Cux1 T C 5: 136,392,107 (GRCm39) probably benign Het
Cyp2b19 T A 7: 26,466,251 (GRCm39) D351E probably benign Het
Dctn1 G T 6: 83,159,614 (GRCm39) G31* probably null Het
Duox1 T A 2: 122,177,122 (GRCm39) probably benign Het
Egflam T G 15: 7,282,911 (GRCm39) E382A possibly damaging Het
Ext1 T C 15: 53,208,542 (GRCm39) N73S probably benign Het
Ffar4 A G 19: 38,102,452 (GRCm39) probably benign Het
Glg1 A T 8: 111,892,214 (GRCm39) M866K probably damaging Het
Golm1 T A 13: 59,792,914 (GRCm39) H197L probably benign Het
Gtse1 A G 15: 85,746,579 (GRCm39) K132E probably damaging Het
Gxylt2 A T 6: 100,710,339 (GRCm39) probably benign Het
Hrc T A 7: 44,986,113 (GRCm39) S421R probably benign Het
Ighg2c T A 12: 113,251,788 (GRCm39) probably benign Het
Ihh A G 1: 74,985,750 (GRCm39) I245T probably benign Het
Ilf3 T A 9: 21,300,010 (GRCm39) M65K possibly damaging Het
Insr A G 8: 3,252,947 (GRCm39) V404A probably damaging Het
Irak2 G T 6: 113,649,914 (GRCm39) probably benign Het
Irak2 G A 6: 113,655,699 (GRCm39) V367I probably benign Het
Kat7 A C 11: 95,191,034 (GRCm39) N119K probably benign Het
Kif9 A G 9: 110,314,106 (GRCm39) I33V probably benign Het
Klf17 A G 4: 117,618,229 (GRCm39) Y43H probably benign Het
Kng2 T A 16: 22,806,313 (GRCm39) T629S possibly damaging Het
Lama1 A T 17: 68,102,181 (GRCm39) probably benign Het
Lamb1 T C 12: 31,328,600 (GRCm39) I188T possibly damaging Het
Lpp T A 16: 24,480,550 (GRCm39) probably benign Het
Lrp12 T C 15: 39,741,635 (GRCm39) E360G probably damaging Het
Mmp3 T C 9: 7,451,910 (GRCm39) probably benign Het
Mthfd1l T A 10: 3,928,727 (GRCm39) probably benign Het
Mtr A T 13: 12,237,112 (GRCm39) S569T probably damaging Het
Myh13 T A 11: 67,258,063 (GRCm39) S1752T probably benign Het
Myo5a T A 9: 75,063,489 (GRCm39) L565H probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Nfkb1 A T 3: 135,300,814 (GRCm39) L72* probably null Het
Numa1 A G 7: 101,658,660 (GRCm39) K296E probably damaging Het
Obi1 T A 14: 104,740,780 (GRCm39) probably null Het
Or51ab3 A T 7: 103,201,529 (GRCm39) Y179F probably damaging Het
Or5ac19 C T 16: 59,089,574 (GRCm39) G152D probably damaging Het
Or5b120 A G 19: 13,479,953 (GRCm39) E82G probably benign Het
Or5h18 T A 16: 58,847,587 (GRCm39) M228L probably benign Het
Or5p80 A G 7: 108,229,759 (GRCm39) I187V probably benign Het
Pcdhb5 A T 18: 37,454,321 (GRCm39) I234F possibly damaging Het
Pgm5 T A 19: 24,661,920 (GRCm39) I545F probably damaging Het
Pla2g2c T C 4: 138,470,901 (GRCm39) probably benign Het
Pnpla7 A T 2: 24,901,618 (GRCm39) E548V probably damaging Het
Ppm1m C A 9: 106,073,895 (GRCm39) E273* probably null Het
Ppp2r1b C T 9: 50,772,873 (GRCm39) R117* probably null Het
Rabgap1l G A 1: 160,059,359 (GRCm39) probably benign Het
Rapgef6 T A 11: 54,437,204 (GRCm39) M49K possibly damaging Het
Rhox4f A C X: 36,789,122 (GRCm39) V15G probably benign Het
Rtel1 T G 2: 180,965,198 (GRCm39) I146M probably damaging Het
Sdr9c7 A T 10: 127,739,541 (GRCm39) M219L probably benign Het
Serpina3g T A 12: 104,206,543 (GRCm39) S115T possibly damaging Het
Serpinb1a A T 13: 33,034,259 (GRCm39) L44Q probably damaging Het
Slc13a4 A G 6: 35,264,297 (GRCm39) I190T possibly damaging Het
Slc46a2 A G 4: 59,914,392 (GRCm39) L177P probably damaging Het
Slc47a2 C T 11: 61,227,068 (GRCm39) V167M possibly damaging Het
Snrnp200 C T 2: 127,076,874 (GRCm39) probably benign Het
Snx13 C A 12: 35,151,123 (GRCm39) probably benign Het
Snx25 C T 8: 46,494,402 (GRCm39) A828T probably damaging Het
Spic A G 10: 88,511,803 (GRCm39) L151P probably damaging Het
Ssu2 G A 6: 112,351,781 (GRCm39) H315Y probably damaging Het
Stk32a T C 18: 43,446,443 (GRCm39) probably benign Het
Tbx3 A T 5: 119,818,511 (GRCm39) E382V probably damaging Het
Tcaf2 A G 6: 42,606,547 (GRCm39) I469T probably benign Het
Tln2 A G 9: 67,147,954 (GRCm39) probably benign Het
Top2a T A 11: 98,888,682 (GRCm39) I1260L probably benign Het
Treml1 C A 17: 48,672,008 (GRCm39) S91* probably null Het
Trim26 T C 17: 37,168,756 (GRCm39) probably benign Het
Trmt11 T C 10: 30,411,239 (GRCm39) N418S probably benign Het
Ttf1 A G 2: 28,974,667 (GRCm39) Y801C probably damaging Het
Usp34 C T 11: 23,414,403 (GRCm39) A2782V probably benign Het
Vmn2r77 T C 7: 86,460,858 (GRCm39) V728A probably benign Het
Vps4a T C 8: 107,763,333 (GRCm39) L29P probably damaging Het
Wdfy3 A G 5: 102,091,899 (GRCm39) I480T probably damaging Het
Wdr41 A G 13: 95,146,795 (GRCm39) I197V probably damaging Het
Ywhag A T 5: 135,940,153 (GRCm39) V147E probably damaging Het
Zan A G 5: 137,401,918 (GRCm39) M4058T unknown Het
Zfp236 C T 18: 82,698,817 (GRCm39) C88Y probably damaging Het
Other mutations in Mark2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Mark2 APN 19 7,318,549 (GRCm39) missense possibly damaging 0.53
IGL01522:Mark2 APN 19 7,258,603 (GRCm39) missense probably benign 0.06
IGL02368:Mark2 APN 19 7,261,855 (GRCm39) missense probably damaging 1.00
IGL02836:Mark2 APN 19 7,255,405 (GRCm39) critical splice donor site probably null
IGL03233:Mark2 APN 19 7,262,091 (GRCm39) missense possibly damaging 0.89
Unprintable UTSW 19 7,263,267 (GRCm39) missense probably damaging 1.00
R0015:Mark2 UTSW 19 7,263,142 (GRCm39) nonsense probably null
R0025:Mark2 UTSW 19 7,263,287 (GRCm39) missense probably damaging 1.00
R0025:Mark2 UTSW 19 7,263,287 (GRCm39) missense probably damaging 1.00
R0035:Mark2 UTSW 19 7,262,017 (GRCm39) splice site probably benign
R0035:Mark2 UTSW 19 7,262,017 (GRCm39) splice site probably benign
R0047:Mark2 UTSW 19 7,260,942 (GRCm39) splice site probably benign
R0335:Mark2 UTSW 19 7,259,193 (GRCm39) missense probably benign 0.27
R0627:Mark2 UTSW 19 7,259,325 (GRCm39) critical splice acceptor site probably null
R0734:Mark2 UTSW 19 7,263,346 (GRCm39) splice site probably benign
R0744:Mark2 UTSW 19 7,263,189 (GRCm39) missense probably damaging 1.00
R0836:Mark2 UTSW 19 7,263,189 (GRCm39) missense probably damaging 1.00
R1099:Mark2 UTSW 19 7,254,790 (GRCm39) missense probably benign 0.41
R1861:Mark2 UTSW 19 7,268,128 (GRCm39) missense possibly damaging 0.73
R1873:Mark2 UTSW 19 7,261,880 (GRCm39) missense probably damaging 1.00
R2160:Mark2 UTSW 19 7,260,112 (GRCm39) missense probably damaging 1.00
R2161:Mark2 UTSW 19 7,260,112 (GRCm39) missense probably damaging 1.00
R2162:Mark2 UTSW 19 7,260,112 (GRCm39) missense probably damaging 1.00
R2308:Mark2 UTSW 19 7,259,299 (GRCm39) missense probably damaging 1.00
R2844:Mark2 UTSW 19 7,264,227 (GRCm39) missense probably damaging 1.00
R2845:Mark2 UTSW 19 7,264,227 (GRCm39) missense probably damaging 1.00
R2846:Mark2 UTSW 19 7,264,227 (GRCm39) missense probably damaging 1.00
R2902:Mark2 UTSW 19 7,260,813 (GRCm39) missense probably benign 0.00
R2935:Mark2 UTSW 19 7,263,254 (GRCm39) missense probably benign 0.09
R3853:Mark2 UTSW 19 7,254,655 (GRCm39) missense probably damaging 1.00
R4377:Mark2 UTSW 19 7,268,054 (GRCm39) missense possibly damaging 0.66
R4522:Mark2 UTSW 19 7,263,313 (GRCm39) missense probably damaging 1.00
R4737:Mark2 UTSW 19 7,258,597 (GRCm39) missense probably damaging 0.96
R5103:Mark2 UTSW 19 7,261,868 (GRCm39) missense probably damaging 1.00
R5154:Mark2 UTSW 19 7,260,439 (GRCm39) missense probably damaging 0.99
R5579:Mark2 UTSW 19 7,260,181 (GRCm39) missense probably damaging 1.00
R6163:Mark2 UTSW 19 7,268,126 (GRCm39) missense probably benign 0.00
R6186:Mark2 UTSW 19 7,260,567 (GRCm39) missense probably benign 0.01
R6387:Mark2 UTSW 19 7,263,267 (GRCm39) missense probably damaging 1.00
R7032:Mark2 UTSW 19 7,264,698 (GRCm39) missense probably damaging 1.00
R7949:Mark2 UTSW 19 7,262,081 (GRCm39) missense probably benign 0.12
R8792:Mark2 UTSW 19 7,258,580 (GRCm39) missense probably benign 0.00
R8825:Mark2 UTSW 19 7,318,571 (GRCm39) missense probably benign 0.00
R8854:Mark2 UTSW 19 7,258,369 (GRCm39) missense probably benign 0.01
R9374:Mark2 UTSW 19 7,263,263 (GRCm39) missense possibly damaging 0.60
R9551:Mark2 UTSW 19 7,263,263 (GRCm39) missense possibly damaging 0.60
R9552:Mark2 UTSW 19 7,263,263 (GRCm39) missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CCTGACTTGAGATTCCCAAGAGCAC -3'
(R):5'- GGCAGCGTCTCTCTTAGTTACCAC -3'

Sequencing Primer
(F):5'- ACATACCCTGGTCACTGGAG -3'
(R):5'- GGAAGGCATGAATTAGTCCTCTC -3'
Posted On 2013-05-09