Incidental Mutation 'R4461:Mtmr11'
ID330134
Institutional Source Beutler Lab
Gene Symbol Mtmr11
Ensembl Gene ENSMUSG00000045934
Gene Namemyotubularin related protein 11
Synonyms
MMRRC Submission 041720-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R4461 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96162004-96171718 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 96167891 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054356] [ENSMUST00000076372] [ENSMUST00000129925]
Predicted Effect probably benign
Transcript: ENSMUST00000054356
SMART Domains Protein: ENSMUSP00000062341
Gene: ENSMUSG00000045934

DomainStartEndE-ValueType
Pfam:Myotub-related 191 323 1.7e-12 PFAM
Pfam:Myotub-related 312 488 1.3e-44 PFAM
Pfam:3-PAP 550 683 2.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076372
SMART Domains Protein: ENSMUSP00000075709
Gene: ENSMUSG00000068856

DomainStartEndE-ValueType
RRM 14 87 1.46e-25 SMART
RRM 101 175 5.07e-25 SMART
low complexity region 214 307 N/A INTRINSIC
low complexity region 310 423 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123520
Predicted Effect probably benign
Transcript: ENSMUST00000129925
SMART Domains Protein: ENSMUSP00000118258
Gene: ENSMUSG00000045934

DomainStartEndE-ValueType
Pfam:Myotub-related 162 264 4.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199721
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,745 L395P probably damaging Het
Ankrd12 T C 17: 65,985,937 probably null Het
Apex1 T C 14: 50,926,513 V165A probably damaging Het
Btbd17 C T 11: 114,793,989 D75N possibly damaging Het
Chd2 T C 7: 73,540,874 probably benign Het
Coq10a T C 10: 128,364,478 N138S possibly damaging Het
Ctbp1 A T 5: 33,251,013 Y192N probably damaging Het
Cx3cl1 A G 8: 94,780,556 *396W probably null Het
D6Ertd527e T C 6: 87,111,317 I154T unknown Het
Dao T A 5: 114,019,926 V203E probably damaging Het
Egr4 G A 6: 85,512,340 A246V probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
H2-Eb2 T A 17: 34,333,523 V114E possibly damaging Het
Hpgds A G 6: 65,123,634 L120P probably damaging Het
Ikbke C T 1: 131,265,922 V464I probably benign Het
Kank2 G A 9: 21,794,745 Q326* probably null Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Klkb1 A G 8: 45,273,575 S464P probably damaging Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Kmt2c A G 5: 25,299,876 V3478A probably benign Het
Knl1 A C 2: 119,059,599 N44T probably benign Het
Letm2 A G 8: 25,586,699 C296R probably damaging Het
Lrrc37a A G 11: 103,464,354 probably null Het
Med20 T C 17: 47,618,917 V93A probably benign Het
Muc1 A T 3: 89,231,563 D493V probably damaging Het
Nek2 C T 1: 191,822,715 P180S probably damaging Het
Nin A T 12: 70,042,585 M1352K probably benign Het
Olfr1110 T C 2: 87,135,661 H220R probably benign Het
P3h3 A T 6: 124,845,568 S547T probably benign Het
Pik3c2g C T 6: 139,841,681 probably benign Het
Pkd1l3 A G 8: 109,632,713 probably null Het
Pzp T C 6: 128,524,040 I118M probably benign Het
Rps6ka5 C A 12: 100,570,864 D536Y probably damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Siglece T C 7: 43,651,505 Q462R probably benign Het
Sirt3 T C 7: 140,865,000 D295G possibly damaging Het
Snph G A 2: 151,593,847 S318L probably benign Het
Snx18 T C 13: 113,617,195 T401A probably damaging Het
Tefm A G 11: 80,138,049 probably null Het
Thada T C 17: 84,426,237 Y994C probably damaging Het
Trmt1 A G 8: 84,699,149 N531D probably benign Het
Ttc17 A G 2: 94,366,571 V477A probably benign Het
Ubxn10 T A 4: 138,720,876 Q163L probably benign Het
Ulk4 A T 9: 121,156,884 I908N possibly damaging Het
Zscan12 C T 13: 21,366,619 S136L possibly damaging Het
Other mutations in Mtmr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02539:Mtmr11 APN 3 96164991 intron probably benign
R1017:Mtmr11 UTSW 3 96164477 missense probably damaging 1.00
R1589:Mtmr11 UTSW 3 96168113 missense probably benign 0.16
R1836:Mtmr11 UTSW 3 96164786 missense probably damaging 0.98
R2264:Mtmr11 UTSW 3 96169097 missense possibly damaging 0.53
R3623:Mtmr11 UTSW 3 96165266 missense probably damaging 1.00
R4195:Mtmr11 UTSW 3 96167891 splice site probably benign
R4243:Mtmr11 UTSW 3 96168077 missense probably damaging 1.00
R4245:Mtmr11 UTSW 3 96168077 missense probably damaging 1.00
R4414:Mtmr11 UTSW 3 96167891 splice site probably benign
R4417:Mtmr11 UTSW 3 96167891 splice site probably benign
R4468:Mtmr11 UTSW 3 96167891 splice site probably benign
R4963:Mtmr11 UTSW 3 96163250 intron probably benign
R5134:Mtmr11 UTSW 3 96169907 missense probably damaging 1.00
R5154:Mtmr11 UTSW 3 96164319 missense probably benign 0.03
R5508:Mtmr11 UTSW 3 96163767 missense probably damaging 1.00
R5821:Mtmr11 UTSW 3 96167869 missense possibly damaging 0.91
R5868:Mtmr11 UTSW 3 96171202 missense possibly damaging 0.65
R5991:Mtmr11 UTSW 3 96168589 unclassified probably null
R6084:Mtmr11 UTSW 3 96168084 missense probably damaging 0.99
R6354:Mtmr11 UTSW 3 96168676 missense probably benign 0.07
R6446:Mtmr11 UTSW 3 96171188 missense probably benign 0.00
R6821:Mtmr11 UTSW 3 96170407 missense probably benign
R7033:Mtmr11 UTSW 3 96169946 missense probably damaging 1.00
R7312:Mtmr11 UTSW 3 96164538 missense possibly damaging 0.68
R7878:Mtmr11 UTSW 3 96169199 missense probably benign 0.00
R7899:Mtmr11 UTSW 3 96170428 missense probably damaging 1.00
R7961:Mtmr11 UTSW 3 96169199 missense probably benign 0.00
R7982:Mtmr11 UTSW 3 96170428 missense probably damaging 1.00
X0019:Mtmr11 UTSW 3 96164492 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCAGACTTCTTATCCCATCTG -3'
(R):5'- CTGGAAGGGCGTGTGATGA -3'

Sequencing Primer
(F):5'- CATAGTCAGCTGCTGTGGACAATC -3'
(R):5'- TGATGAAGAAGGGAGTAATGTATTGG -3'
Posted On2015-07-21