Incidental Mutation 'R4461:Pik3c2g'
ID330145
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
MMRRC Submission 041720-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R4461 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location139587221-139969284 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 139841681 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]
Predicted Effect probably benign
Transcript: ENSMUST00000087657
SMART Domains Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111868
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187223
SMART Domains Protein: ENSMUSP00000140589
Gene: ENSMUSG00000030228

DomainStartEndE-ValueType
Pfam:PI3_PI4_kinase 123 226 3.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189374
SMART Domains Protein: ENSMUSP00000139763
Gene: ENSMUSG00000030228

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206646
Predicted Effect probably benign
Transcript: ENSMUST00000218528
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,745 L395P probably damaging Het
Ankrd12 T C 17: 65,985,937 probably null Het
Apex1 T C 14: 50,926,513 V165A probably damaging Het
Btbd17 C T 11: 114,793,989 D75N possibly damaging Het
Chd2 T C 7: 73,540,874 probably benign Het
Coq10a T C 10: 128,364,478 N138S possibly damaging Het
Ctbp1 A T 5: 33,251,013 Y192N probably damaging Het
Cx3cl1 A G 8: 94,780,556 *396W probably null Het
D6Ertd527e T C 6: 87,111,317 I154T unknown Het
Dao T A 5: 114,019,926 V203E probably damaging Het
Egr4 G A 6: 85,512,340 A246V probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
H2-Eb2 T A 17: 34,333,523 V114E possibly damaging Het
Hpgds A G 6: 65,123,634 L120P probably damaging Het
Ikbke C T 1: 131,265,922 V464I probably benign Het
Kank2 G A 9: 21,794,745 Q326* probably null Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Klkb1 A G 8: 45,273,575 S464P probably damaging Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Kmt2c A G 5: 25,299,876 V3478A probably benign Het
Knl1 A C 2: 119,059,599 N44T probably benign Het
Letm2 A G 8: 25,586,699 C296R probably damaging Het
Lrrc37a A G 11: 103,464,354 probably null Het
Med20 T C 17: 47,618,917 V93A probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Muc1 A T 3: 89,231,563 D493V probably damaging Het
Nek2 C T 1: 191,822,715 P180S probably damaging Het
Nin A T 12: 70,042,585 M1352K probably benign Het
Olfr1110 T C 2: 87,135,661 H220R probably benign Het
P3h3 A T 6: 124,845,568 S547T probably benign Het
Pkd1l3 A G 8: 109,632,713 probably null Het
Pzp T C 6: 128,524,040 I118M probably benign Het
Rps6ka5 C A 12: 100,570,864 D536Y probably damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Siglece T C 7: 43,651,505 Q462R probably benign Het
Sirt3 T C 7: 140,865,000 D295G possibly damaging Het
Snph G A 2: 151,593,847 S318L probably benign Het
Snx18 T C 13: 113,617,195 T401A probably damaging Het
Tefm A G 11: 80,138,049 probably null Het
Thada T C 17: 84,426,237 Y994C probably damaging Het
Trmt1 A G 8: 84,699,149 N531D probably benign Het
Ttc17 A G 2: 94,366,571 V477A probably benign Het
Ubxn10 T A 4: 138,720,876 Q163L probably benign Het
Ulk4 A T 9: 121,156,884 I908N possibly damaging Het
Zscan12 C T 13: 21,366,619 S136L possibly damaging Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 unclassified probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense probably damaging 1.00
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7651:Pik3c2g UTSW 6 139622072 missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139896744 missense
R8005:Pik3c2g UTSW 6 139622069 missense probably benign 0.01
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGATGGTTTACGCCAGCT -3'
(R):5'- AACCAACCAACAAACCAACTTAG -3'

Sequencing Primer
(F):5'- GATGGTTTACGCCAGCTGTCAAC -3'
(R):5'- ACTTAGCAACCAATCATCCAATC -3'
Posted On2015-07-21