Mutagenetix > Incidental Mutation

Incidental Mutation 'R4461:Chd2'

330147

Institutional Source

Beutler Lab

Gene Symbol

Chd2

Ensembl Gene

ENSMUSG00000078671

Gene Name

chromodomain helicase DNA binding protein 2

Synonyms

5630401D06Rik, 2810013C04Rik, 2810040A01Rik

MMRRC Submission

041720-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.578) question?

Stock #

R4461 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73076400-73191494 bp(-) (GRCm39)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 73190622 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026895] [ENSMUST00000169922] [ENSMUST00000172704] [ENSMUST00000197642]

AlphaFold

E9PZM4

Predicted Effect

probably benign
Transcript: ENSMUST00000026895

SMART Domains

Protein: ENSMUSP00000026895
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
low complexity region	13	75	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	126	136	N/A	INTRINSIC
low complexity region	146	160	N/A	INTRINSIC
low complexity region	199	208	N/A	INTRINSIC
CHROMO	224	310	2.3e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169922

SMART Domains

Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
low complexity region	13	75	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	126	136	N/A	INTRINSIC
low complexity region	176	196	N/A	INTRINSIC
low complexity region	235	244	N/A	INTRINSIC
CHROMO	260	346	3.64e-19	SMART
CHROMO	376	449	7.99e-16	SMART
DEXDc	480	677	1.93e-37	SMART
Blast:DEXDc	678	729	2e-18	BLAST
low complexity region	793	806	N/A	INTRINSIC
HELICc	821	905	1.2e-24	SMART
Blast:DEXDc	960	1244	4e-63	BLAST
PDB:4B4C\|A	1128	1316	5e-78	PDB
low complexity region	1317	1329	N/A	INTRINSIC
low complexity region	1338	1351	N/A	INTRINSIC
low complexity region	1389	1403	N/A	INTRINSIC
low complexity region	1407	1441	N/A	INTRINSIC
DUF4208	1451	1555	1.85e-52	SMART
low complexity region	1557	1572	N/A	INTRINSIC
low complexity region	1704	1729	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172704

SMART Domains

Protein: ENSMUSP00000134484
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
low complexity region	34	89	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183916

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184554

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184587

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184855

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200218

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200492

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190028

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187421

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206776

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189960

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197800

Predicted Effect

probably benign
Transcript: ENSMUST00000197642

SMART Domains

Protein: ENSMUSP00000142408
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
Blast:CHROMO	1	58	5e-22	BLAST

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]

Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd12	T	C	17: 66,292,932 (GRCm39)		probably null	Het
Apex1	T	C	14: 51,163,970 (GRCm39)	V165A	probably damaging	Het
Btbd17	C	T	11: 114,684,815 (GRCm39)	D75N	possibly damaging	Het
Coq10a	T	C	10: 128,200,347 (GRCm39)	N138S	possibly damaging	Het
Ctbp1	A	T	5: 33,408,357 (GRCm39)	Y192N	probably damaging	Het
Cx3cl1	A	G	8: 95,507,184 (GRCm39)	*396W	probably null	Het
D6Ertd527e	T	C	6: 87,088,299 (GRCm39)	I154T	unknown	Het
Dao	T	A	5: 114,157,987 (GRCm39)	V203E	probably damaging	Het
Egr4	G	A	6: 85,489,322 (GRCm39)	A246V	probably damaging	Het
Gpsm1	G	A	2: 26,209,843 (GRCm39)		probably benign	Het
H2-Eb2	T	A	17: 34,552,497 (GRCm39)	V114E	possibly damaging	Het
Hpgds	A	G	6: 65,100,618 (GRCm39)	L120P	probably damaging	Het
Ikbke	C	T	1: 131,193,659 (GRCm39)	V464I	probably benign	Het
Kank2	G	A	9: 21,706,041 (GRCm39)	Q326*	probably null	Het
Klhl26	T	C	8: 70,904,194 (GRCm39)	Y538C	probably damaging	Het
Klkb1	A	G	8: 45,726,612 (GRCm39)	S464P	probably damaging	Het
Kmt2a	A	G	9: 44,760,263 (GRCm39)	Y529H	probably damaging	Het
Kmt2c	A	G	5: 25,504,874 (GRCm39)	V3478A	probably benign	Het
Knl1	A	C	2: 118,890,080 (GRCm39)	N44T	probably benign	Het
Letm2	A	G	8: 26,076,715 (GRCm39)	C296R	probably damaging	Het
Lrrc37a	A	G	11: 103,355,180 (GRCm39)		probably null	Het
Med20	T	C	17: 47,929,842 (GRCm39)	V93A	probably benign	Het
Mtmr11	T	C	3: 96,075,207 (GRCm39)		probably benign	Het
Muc1	A	T	3: 89,138,870 (GRCm39)	D493V	probably damaging	Het
Nek2	C	T	1: 191,554,827 (GRCm39)	P180S	probably damaging	Het
Nin	A	T	12: 70,089,359 (GRCm39)	M1352K	probably benign	Het
Or5aq1	T	C	2: 86,966,005 (GRCm39)	H220R	probably benign	Het
P3h3	A	T	6: 124,822,531 (GRCm39)	S547T	probably benign	Het
Pik3c2g	C	T	6: 139,787,407 (GRCm39)		probably benign	Het
Pkd1l3	A	G	8: 110,359,345 (GRCm39)		probably null	Het
Pzp	T	C	6: 128,501,003 (GRCm39)	I118M	probably benign	Het
Rps6ka5	C	A	12: 100,537,123 (GRCm39)	D536Y	probably damaging	Het
Rps6-ps2	A	G	8: 89,533,319 (GRCm39)		noncoding transcript	Het
Siglece	T	C	7: 43,300,929 (GRCm39)	Q462R	probably benign	Het
Sirt3	T	C	7: 140,444,913 (GRCm39)	D295G	possibly damaging	Het
Snph	G	A	2: 151,435,767 (GRCm39)	S318L	probably benign	Het
Snx18	T	C	13: 113,753,731 (GRCm39)	T401A	probably damaging	Het
Tefm	A	G	11: 80,028,875 (GRCm39)		probably null	Het
Thada	T	C	17: 84,733,665 (GRCm39)	Y994C	probably damaging	Het
Trmt1	A	G	8: 85,425,778 (GRCm39)	N531D	probably benign	Het
Ttc17	A	G	2: 94,196,916 (GRCm39)	V477A	probably benign	Het
Ubxn10	T	A	4: 138,448,187 (GRCm39)	Q163L	probably benign	Het
Ulk4	A	T	9: 120,985,950 (GRCm39)	I908N	possibly damaging	Het
Zfp747l1	A	G	7: 126,983,917 (GRCm39)	L395P	probably damaging	Het
Zscan12	C	T	13: 21,550,789 (GRCm39)	S136L	possibly damaging	Het

Other mutations in Chd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Chd2	APN	7	73,118,325 (GRCm39)	missense	probably damaging	0.99
IGL00535:Chd2	APN	7	73,190,576 (GRCm39)	missense	probably benign	0.01
IGL00961:Chd2	APN	7	73,093,997 (GRCm39)	missense	probably damaging	0.99
IGL01092:Chd2	APN	7	73,091,434 (GRCm39)	missense	possibly damaging	0.69
IGL02035:Chd2	APN	7	73,091,375 (GRCm39)	splice site	probably null
IGL02083:Chd2	APN	7	73,130,816 (GRCm39)	missense	possibly damaging	0.95
IGL02205:Chd2	APN	7	73,091,465 (GRCm39)	missense	probably benign	0.01
IGL02243:Chd2	APN	7	73,147,456 (GRCm39)	splice site	probably null
IGL02385:Chd2	APN	7	73,085,570 (GRCm39)	missense	probably damaging	1.00
IGL02552:Chd2	APN	7	73,097,068 (GRCm39)	unclassified	probably benign
IGL02590:Chd2	APN	7	73,102,948 (GRCm39)	missense	probably benign	0.00
IGL02684:Chd2	APN	7	73,125,097 (GRCm39)	missense	probably damaging	0.99
IGL02731:Chd2	APN	7	73,143,204 (GRCm39)	missense	probably damaging	0.99
IGL03272:Chd2	APN	7	73,102,914 (GRCm39)	missense	possibly damaging	0.94
1mM(1):Chd2	UTSW	7	73,151,852 (GRCm39)	missense	possibly damaging	0.65
A4554:Chd2	UTSW	7	73,130,716 (GRCm39)	missense	probably benign
F6893:Chd2	UTSW	7	73,157,620 (GRCm39)	missense	possibly damaging	0.92
R0012:Chd2	UTSW	7	73,105,267 (GRCm39)	missense	probably damaging	1.00
R0012:Chd2	UTSW	7	73,105,267 (GRCm39)	missense	probably damaging	1.00
R0068:Chd2	UTSW	7	73,134,282 (GRCm39)	missense	probably damaging	1.00
R0763:Chd2	UTSW	7	73,097,022 (GRCm39)	missense	possibly damaging	0.74
R0973:Chd2	UTSW	7	73,128,412 (GRCm39)	missense	probably damaging	1.00
R0973:Chd2	UTSW	7	73,128,412 (GRCm39)	missense	probably damaging	1.00
R0974:Chd2	UTSW	7	73,128,412 (GRCm39)	missense	probably damaging	1.00
R1223:Chd2	UTSW	7	73,134,265 (GRCm39)	missense	probably damaging	1.00
R1435:Chd2	UTSW	7	73,102,884 (GRCm39)	missense	probably damaging	0.99
R1527:Chd2	UTSW	7	73,140,362 (GRCm39)	nonsense	probably null
R1599:Chd2	UTSW	7	73,122,799 (GRCm39)	missense	probably benign	0.05
R1657:Chd2	UTSW	7	73,130,178 (GRCm39)	missense	probably damaging	1.00
R1932:Chd2	UTSW	7	73,104,193 (GRCm39)	missense	probably damaging	0.99
R2110:Chd2	UTSW	7	73,079,735 (GRCm39)	missense	probably benign	0.00
R2202:Chd2	UTSW	7	73,128,416 (GRCm39)	missense	probably benign	0.00
R2383:Chd2	UTSW	7	73,153,168 (GRCm39)	missense	possibly damaging	0.89
R2393:Chd2	UTSW	7	73,157,631 (GRCm39)	missense	possibly damaging	0.92
R3699:Chd2	UTSW	7	73,118,238 (GRCm39)	missense	probably benign	0.35
R3713:Chd2	UTSW	7	73,121,538 (GRCm39)	unclassified	probably benign
R3788:Chd2	UTSW	7	73,096,878 (GRCm39)	unclassified	probably benign
R3826:Chd2	UTSW	7	73,141,163 (GRCm39)	missense	possibly damaging	0.71
R3828:Chd2	UTSW	7	73,141,163 (GRCm39)	missense	possibly damaging	0.71
R3830:Chd2	UTSW	7	73,141,163 (GRCm39)	missense	possibly damaging	0.71
R3966:Chd2	UTSW	7	73,114,143 (GRCm39)	splice site	probably benign
R4093:Chd2	UTSW	7	73,150,764 (GRCm39)	missense	possibly damaging	0.70
R4431:Chd2	UTSW	7	73,085,709 (GRCm39)	missense	possibly damaging	0.56
R4782:Chd2	UTSW	7	73,134,184 (GRCm39)	missense	possibly damaging	0.80
R4791:Chd2	UTSW	7	73,118,325 (GRCm39)	missense	probably benign	0.13
R4792:Chd2	UTSW	7	73,118,325 (GRCm39)	missense	probably benign	0.13
R4799:Chd2	UTSW	7	73,134,184 (GRCm39)	missense	possibly damaging	0.80
R4832:Chd2	UTSW	7	73,151,873 (GRCm39)	missense	probably damaging	1.00
R5055:Chd2	UTSW	7	73,130,256 (GRCm39)	missense	probably damaging	1.00
R5071:Chd2	UTSW	7	73,079,437 (GRCm39)	missense	probably benign	0.03
R5328:Chd2	UTSW	7	73,113,429 (GRCm39)	missense	possibly damaging	0.96
R5444:Chd2	UTSW	7	73,122,833 (GRCm39)	missense	probably damaging	1.00
R5643:Chd2	UTSW	7	73,134,232 (GRCm39)	missense	probably damaging	1.00
R5666:Chd2	UTSW	7	73,091,465 (GRCm39)	missense	probably benign	0.01
R5670:Chd2	UTSW	7	73,091,465 (GRCm39)	missense	probably benign	0.01
R5706:Chd2	UTSW	7	73,141,105 (GRCm39)	missense	possibly damaging	0.74
R5825:Chd2	UTSW	7	73,134,350 (GRCm39)	splice site	probably null
R5834:Chd2	UTSW	7	73,128,463 (GRCm39)	missense	probably damaging	1.00
R5920:Chd2	UTSW	7	73,187,060 (GRCm39)	missense	probably damaging	0.97
R6051:Chd2	UTSW	7	73,085,590 (GRCm39)	missense	probably benign	0.00
R6179:Chd2	UTSW	7	73,094,071 (GRCm39)	missense	probably damaging	0.98
R6229:Chd2	UTSW	7	73,101,471 (GRCm39)	missense	possibly damaging	0.76
R6267:Chd2	UTSW	7	73,113,419 (GRCm39)	missense	probably damaging	0.99
R6310:Chd2	UTSW	7	73,102,912 (GRCm39)	missense	probably damaging	1.00
R6439:Chd2	UTSW	7	73,130,154 (GRCm39)	missense	probably damaging	1.00
R6444:Chd2	UTSW	7	73,150,785 (GRCm39)	critical splice acceptor site	probably null
R6529:Chd2	UTSW	7	73,153,191 (GRCm39)	missense	possibly damaging	0.89
R6611:Chd2	UTSW	7	73,143,313 (GRCm39)	missense	probably damaging	0.99
R6661:Chd2	UTSW	7	73,140,230 (GRCm39)	missense	possibly damaging	0.95
R6782:Chd2	UTSW	7	73,125,127 (GRCm39)	nonsense	probably null
R6860:Chd2	UTSW	7	73,147,558 (GRCm39)	missense	possibly damaging	0.95
R6955:Chd2	UTSW	7	73,125,171 (GRCm39)	missense	probably damaging	1.00
R6984:Chd2	UTSW	7	73,134,159 (GRCm39)	nonsense	probably null
R7095:Chd2	UTSW	7	73,121,629 (GRCm39)	missense	probably damaging	1.00
R7121:Chd2	UTSW	7	73,119,418 (GRCm39)	missense	probably benign	0.00
R7179:Chd2	UTSW	7	73,125,168 (GRCm39)	missense	probably damaging	1.00
R7500:Chd2	UTSW	7	73,101,556 (GRCm39)	missense	probably damaging	1.00
R7615:Chd2	UTSW	7	73,091,390 (GRCm39)	missense	probably damaging	0.97
R7646:Chd2	UTSW	7	73,085,521 (GRCm39)	missense	possibly damaging	0.49
R7764:Chd2	UTSW	7	73,121,567 (GRCm39)	missense	probably null	1.00
R7898:Chd2	UTSW	7	73,169,223 (GRCm39)	critical splice donor site	probably null
R7935:Chd2	UTSW	7	73,149,373 (GRCm39)	missense	probably benign	0.01
R8033:Chd2	UTSW	7	73,085,628 (GRCm39)	missense	probably damaging	1.00
R8070:Chd2	UTSW	7	73,101,506 (GRCm39)	missense	probably benign
R8071:Chd2	UTSW	7	73,187,132 (GRCm39)	missense	probably benign
R8188:Chd2	UTSW	7	73,079,504 (GRCm39)	nonsense	probably null
R8196:Chd2	UTSW	7	73,118,285 (GRCm39)	missense	probably benign	0.00
R8258:Chd2	UTSW	7	73,085,532 (GRCm39)	missense	probably benign	0.11
R8259:Chd2	UTSW	7	73,085,532 (GRCm39)	missense	probably benign	0.11
R8357:Chd2	UTSW	7	73,096,985 (GRCm39)	missense	probably damaging	0.99
R8457:Chd2	UTSW	7	73,096,985 (GRCm39)	missense	probably damaging	0.99
R8778:Chd2	UTSW	7	73,079,483 (GRCm39)	missense	possibly damaging	0.88
R8816:Chd2	UTSW	7	73,140,245 (GRCm39)	missense	probably damaging	1.00
R8875:Chd2	UTSW	7	73,151,783 (GRCm39)	missense	probably damaging	1.00
R8935:Chd2	UTSW	7	73,153,210 (GRCm39)	missense	possibly damaging	0.47
R9005:Chd2	UTSW	7	73,134,294 (GRCm39)	missense	probably damaging	0.98
R9009:Chd2	UTSW	7	73,143,192 (GRCm39)	missense	probably benign	0.39
R9009:Chd2	UTSW	7	73,140,402 (GRCm39)	missense	probably benign	0.12
R9021:Chd2	UTSW	7	73,091,393 (GRCm39)	missense	probably benign	0.03
R9038:Chd2	UTSW	7	73,105,358 (GRCm39)	missense	probably damaging	1.00
R9064:Chd2	UTSW	7	73,143,279 (GRCm39)	missense	possibly damaging	0.70
R9383:Chd2	UTSW	7	73,098,918 (GRCm39)	missense	probably null	1.00
R9501:Chd2	UTSW	7	73,130,294 (GRCm39)	missense	probably damaging	1.00
R9501:Chd2	UTSW	7	73,091,481 (GRCm39)	missense	possibly damaging	0.92
R9550:Chd2	UTSW	7	73,119,439 (GRCm39)	missense	probably damaging	0.99
R9583:Chd2	UTSW	7	73,130,230 (GRCm39)	missense	probably damaging	0.99
R9665:Chd2	UTSW	7	73,079,555 (GRCm39)	missense	probably benign	0.00
RF009:Chd2	UTSW	7	73,169,410 (GRCm39)	missense	possibly damaging	0.73
X0025:Chd2	UTSW	7	73,157,585 (GRCm39)	missense	probably benign	0.11
Z1177:Chd2	UTSW	7	73,118,334 (GRCm39)	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- AGTGTAAGCTGAGGTTTCCC -3'
(R):5'- TGAGAAATTCCTGGATGACGC -3'

Sequencing Primer
(F):5'- TTGCTGTGTAGCGAACTG -3'
(R):5'- TTCCTGGATGACGCAATAAGATAG -3'

Posted On

2015-07-21