Incidental Mutation 'R4461:H2-Eb2'
ID330171
Institutional Source Beutler Lab
Gene Symbol H2-Eb2
Ensembl Gene ENSMUSG00000067341
Gene Namehistocompatibility 2, class II antigen E beta2
SynonymsA130038H09Rik, Ia5, H-2Eb2, Ia-5
MMRRC Submission 041720-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4461 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34325665-34340229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34333523 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 114 (V114E)
Ref Sequence ENSEMBL: ENSMUSP00000056814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050325]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050325
AA Change: V114E

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056814
Gene: ENSMUSG00000067341
AA Change: V114E

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
MHC_II_beta 42 115 8.29e-35 SMART
IGc1 140 211 1.24e-26 SMART
transmembrane domain 227 249 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,745 L395P probably damaging Het
Ankrd12 T C 17: 65,985,937 probably null Het
Apex1 T C 14: 50,926,513 V165A probably damaging Het
Btbd17 C T 11: 114,793,989 D75N possibly damaging Het
Chd2 T C 7: 73,540,874 probably benign Het
Coq10a T C 10: 128,364,478 N138S possibly damaging Het
Ctbp1 A T 5: 33,251,013 Y192N probably damaging Het
Cx3cl1 A G 8: 94,780,556 *396W probably null Het
D6Ertd527e T C 6: 87,111,317 I154T unknown Het
Dao T A 5: 114,019,926 V203E probably damaging Het
Egr4 G A 6: 85,512,340 A246V probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Hpgds A G 6: 65,123,634 L120P probably damaging Het
Ikbke C T 1: 131,265,922 V464I probably benign Het
Kank2 G A 9: 21,794,745 Q326* probably null Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Klkb1 A G 8: 45,273,575 S464P probably damaging Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Kmt2c A G 5: 25,299,876 V3478A probably benign Het
Knl1 A C 2: 119,059,599 N44T probably benign Het
Letm2 A G 8: 25,586,699 C296R probably damaging Het
Lrrc37a A G 11: 103,464,354 probably null Het
Med20 T C 17: 47,618,917 V93A probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Muc1 A T 3: 89,231,563 D493V probably damaging Het
Nek2 C T 1: 191,822,715 P180S probably damaging Het
Nin A T 12: 70,042,585 M1352K probably benign Het
Olfr1110 T C 2: 87,135,661 H220R probably benign Het
P3h3 A T 6: 124,845,568 S547T probably benign Het
Pik3c2g C T 6: 139,841,681 probably benign Het
Pkd1l3 A G 8: 109,632,713 probably null Het
Pzp T C 6: 128,524,040 I118M probably benign Het
Rps6ka5 C A 12: 100,570,864 D536Y probably damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Siglece T C 7: 43,651,505 Q462R probably benign Het
Sirt3 T C 7: 140,865,000 D295G possibly damaging Het
Snph G A 2: 151,593,847 S318L probably benign Het
Snx18 T C 13: 113,617,195 T401A probably damaging Het
Tefm A G 11: 80,138,049 probably null Het
Thada T C 17: 84,426,237 Y994C probably damaging Het
Trmt1 A G 8: 84,699,149 N531D probably benign Het
Ttc17 A G 2: 94,366,571 V477A probably benign Het
Ubxn10 T A 4: 138,720,876 Q163L probably benign Het
Ulk4 A T 9: 121,156,884 I908N possibly damaging Het
Zscan12 C T 13: 21,366,619 S136L possibly damaging Het
Other mutations in H2-Eb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:H2-Eb2 APN 17 34334367 missense probably damaging 0.98
IGL00965:H2-Eb2 APN 17 34325797 splice site probably null
IGL01380:H2-Eb2 APN 17 34335809 missense probably benign 0.41
IGL02057:H2-Eb2 APN 17 34335767 splice site probably benign
IGL02190:H2-Eb2 APN 17 34334374 missense probably damaging 1.00
IGL02220:H2-Eb2 APN 17 34325687 utr 5 prime probably benign
R0469:H2-Eb2 UTSW 17 34334244 nonsense probably null
R0510:H2-Eb2 UTSW 17 34334244 nonsense probably null
R1169:H2-Eb2 UTSW 17 34333357 missense possibly damaging 0.89
R1334:H2-Eb2 UTSW 17 34334350 missense probably damaging 0.99
R1598:H2-Eb2 UTSW 17 34334374 missense probably damaging 1.00
R1991:H2-Eb2 UTSW 17 34334304 missense probably benign 0.15
R2103:H2-Eb2 UTSW 17 34334304 missense probably benign 0.15
R4191:H2-Eb2 UTSW 17 34344555 unclassified probably benign
R4194:H2-Eb2 UTSW 17 34333326 missense probably benign
R4774:H2-Eb2 UTSW 17 34334401 missense probably damaging 0.99
R4882:H2-Eb2 UTSW 17 34334256 missense probably benign
R5663:H2-Eb2 UTSW 17 34333408 missense possibly damaging 0.92
R6913:H2-Eb2 UTSW 17 34333549 missense possibly damaging 0.89
R7139:H2-Eb2 UTSW 17 34334421 missense probably benign 0.30
R7457:H2-Eb2 UTSW 17 34334347 missense probably damaging 1.00
Z1176:H2-Eb2 UTSW 17 34334309 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CAGTTGAAGGCTGAGTGTCAC -3'
(R):5'- ATGATCTCCACACACGTGAC -3'

Sequencing Primer
(F):5'- AAGGCTGAGTGTCACTACTTC -3'
(R):5'- GTGACACAGAACTCTCCTCTC -3'
Posted On2015-07-21