Incidental Mutation 'R4462:Btnl6'
ID 330201
Institutional Source Beutler Lab
Gene Symbol Btnl6
Ensembl Gene ENSMUSG00000092618
Gene Name butyrophilin-like 6
Synonyms Gm6519, NG13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R4462 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34507804-34517352 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34508057 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 500 (S500P)
Ref Sequence ENSEMBL: ENSMUSP00000074927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075483]
AlphaFold A2CG22
Predicted Effect probably damaging
Transcript: ENSMUST00000075483
AA Change: S500P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074927
Gene: ENSMUSG00000092618
AA Change: S500P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 145 2.06e-5 SMART
SCOP:d1c5ch2 151 222 1e-2 SMART
Blast:IG_like 152 228 2e-23 BLAST
transmembrane domain 252 271 N/A INTRINSIC
low complexity region 312 326 N/A INTRINSIC
SPRY 384 509 1.23e-19 SMART
low complexity region 510 539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173164
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A T 6: 55,480,099 I272F possibly damaging Het
Adgrl3 C T 5: 81,688,510 A705V probably damaging Het
Arhgef12 A T 9: 42,981,982 V975E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Ccdc39 C T 3: 33,814,668 R798Q probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cdon T C 9: 35,457,580 V34A probably damaging Het
Defa17 A G 8: 21,656,537 R60G probably benign Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Fuca2 T C 10: 13,503,235 V41A probably damaging Het
Ggt6 C A 11: 72,437,828 H385N possibly damaging Het
Hgsnat G A 8: 25,954,636 T428I probably damaging Het
Nefh A G 11: 4,941,015 S535P probably damaging Het
Olfr1371 T A 11: 52,213,974 N5I probably damaging Het
Olfr905 T A 9: 38,473,064 F106I probably benign Het
Pkhd1l1 T C 15: 44,581,804 F3691L probably damaging Het
Polr2a T C 11: 69,746,403 D282G probably damaging Het
Ranbp17 T C 11: 33,217,421 probably null Het
Slc13a2 T C 11: 78,404,387 T187A probably benign Het
Slco3a1 A C 7: 74,554,563 S10A probably benign Het
Snph A T 2: 151,594,115 S229T probably damaging Het
Trim38 A G 13: 23,791,452 Y458C probably null Het
Ubr4 A G 4: 139,418,502 M1537V possibly damaging Het
Other mutations in Btnl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Btnl6 APN 17 34514043 missense probably benign 0.00
IGL02501:Btnl6 APN 17 34515674 missense possibly damaging 0.82
IGL02539:Btnl6 APN 17 34508314 missense probably benign 0.00
IGL02629:Btnl6 APN 17 34514468 missense probably damaging 1.00
IGL02724:Btnl6 APN 17 34508175 nonsense probably null
IGL03366:Btnl6 APN 17 34508179 missense probably damaging 1.00
R0013:Btnl6 UTSW 17 34515531 nonsense probably null
R0025:Btnl6 UTSW 17 34514299 missense probably benign 0.02
R0144:Btnl6 UTSW 17 34514020 missense probably benign 0.29
R0255:Btnl6 UTSW 17 34508503 missense probably benign 0.01
R1474:Btnl6 UTSW 17 34513646 missense probably damaging 1.00
R1757:Btnl6 UTSW 17 34514088 missense probably benign 0.09
R1838:Btnl6 UTSW 17 34515542 missense probably damaging 0.99
R2149:Btnl6 UTSW 17 34514347 missense possibly damaging 0.47
R2994:Btnl6 UTSW 17 34515524 missense possibly damaging 0.82
R3441:Btnl6 UTSW 17 34508318 missense probably benign 0.06
R3809:Btnl6 UTSW 17 34508228 missense probably benign 0.00
R3936:Btnl6 UTSW 17 34517342 missense probably benign
R4604:Btnl6 UTSW 17 34508461 missense possibly damaging 0.91
R4618:Btnl6 UTSW 17 34514146 missense probably damaging 0.98
R4832:Btnl6 UTSW 17 34513992 missense possibly damaging 0.80
R5369:Btnl6 UTSW 17 34507985 nonsense probably null
R5422:Btnl6 UTSW 17 34514107 missense possibly damaging 0.93
R6046:Btnl6 UTSW 17 34508397 missense probably damaging 1.00
R6170:Btnl6 UTSW 17 34515506 missense probably damaging 0.99
R6385:Btnl6 UTSW 17 34508369 missense probably benign 0.01
R8213:Btnl6 UTSW 17 34508883 splice site probably null
R8676:Btnl6 UTSW 17 34508069 missense probably benign 0.00
R8895:Btnl6 UTSW 17 34515417 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTCTTCCCCTGGGATAGAGTC -3'
(R):5'- GGCCTATATTGACTCTGGGAGG -3'

Sequencing Primer
(F):5'- GTCCACAACACAAGAGCCTGG -3'
(R):5'- GGACTTCATTATCTGTCAGGCAAGC -3'
Posted On 2015-07-21