Incidental Mutation 'R4463:Olfr1340'
ID330216
Institutional Source Beutler Lab
Gene Symbol Olfr1340
Ensembl Gene ENSMUSG00000070821
Gene Nameolfactory receptor 1340
SynonymsGA_x6K02T2QD9B-18823451-18822504, MOR258-6
MMRRC Submission 041721-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4463 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location118720138-118729395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118726658 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 137 (V137A)
Ref Sequence ENSEMBL: ENSMUSP00000149563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094834] [ENSMUST00000213436] [ENSMUST00000216242] [ENSMUST00000217334]
Predicted Effect probably benign
Transcript: ENSMUST00000094834
AA Change: V137A

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092430
Gene: ENSMUSG00000070821
AA Change: V137A

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 4.4e-57 PFAM
Pfam:7tm_1 44 293 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213436
AA Change: V137A

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216242
AA Change: V137A

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000217334
AA Change: V137A

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,150,719 M1197V probably benign Het
Abcb1a T C 5: 8,719,981 probably benign Het
Abcc8 T C 7: 46,106,581 probably null Het
Alox12e A G 11: 70,318,256 L388P probably damaging Het
Aspm T A 1: 139,455,010 S27T possibly damaging Het
Capn2 G A 1: 182,479,764 probably benign Het
Catspere1 G A 1: 177,937,713 noncoding transcript Het
Ccdc158 T C 5: 92,634,300 D820G probably null Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Chd9 T A 8: 90,978,999 D761E probably benign Het
Chst8 T C 7: 34,675,220 D398G probably damaging Het
Clns1a T C 7: 97,720,949 probably benign Het
Cyp3a57 A T 5: 145,381,274 Y355F probably damaging Het
Cyp4f37 A G 17: 32,627,736 probably null Het
Eipr1 G A 12: 28,859,339 A202T probably damaging Het
Fam83a T C 15: 57,995,259 S232P probably damaging Het
Fastkd2 C T 1: 63,735,809 probably benign Het
Fgfr4 G A 13: 55,156,467 V107I probably benign Het
Gatad1 G T 5: 3,647,404 S72R probably benign Het
Gli2 T C 1: 118,836,008 D1471G probably damaging Het
Gm1330 A T 2: 149,003,144 Y36* probably null Het
Gm2056 A G 12: 88,027,359 D119G probably benign Het
Gm29125 T C 1: 80,383,186 noncoding transcript Het
Idi1 G A 13: 8,887,472 probably benign Het
Itgbl1 C T 14: 123,840,668 T190I probably damaging Het
Kbtbd3 G A 9: 4,331,257 G544R probably damaging Het
Kifc3 T C 8: 95,102,116 T638A probably damaging Het
Lama1 G A 17: 67,761,700 C798Y probably damaging Het
Larp6 C A 9: 60,736,996 H140N probably damaging Het
Mctp1 A T 13: 76,712,087 D108V probably damaging Het
Myzap G T 9: 71,555,651 D204E probably benign Het
Neb GCC GC 2: 52,279,722 probably null Het
Olfr1189 T C 2: 88,592,632 V276A possibly damaging Het
Olfr352 T C 2: 36,870,193 I209T probably benign Het
Phka1 A G X: 102,545,384 V818A probably benign Het
Plek T C 11: 16,981,873 Y326C possibly damaging Het
Pp2d1 A G 17: 53,515,858 I60T probably benign Het
Prmt3 T C 7: 49,818,089 Y348H probably damaging Het
Psg27 G T 7: 18,557,085 Q398K possibly damaging Het
Raver1 T C 9: 21,091,827 T51A probably benign Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Sectm1a T A 11: 121,069,651 I113L probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Snph A T 2: 151,594,115 S229T probably damaging Het
Stpg4 A G 17: 87,389,673 F183L probably benign Het
Tango6 A T 8: 106,689,074 T176S probably benign Het
Vmn1r196 A G 13: 22,293,683 Q164R probably benign Het
Vstm4 T A 14: 32,917,876 L236Q probably damaging Het
Xylb A G 9: 119,386,367 D462G probably benign Het
Zc2hc1c A G 12: 85,290,297 R243G probably damaging Het
Other mutations in Olfr1340
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0153:Olfr1340 UTSW 4 118726333 missense possibly damaging 0.86
R0335:Olfr1340 UTSW 4 118727170 missense probably null
R0517:Olfr1340 UTSW 4 118726634 missense probably damaging 1.00
R6240:Olfr1340 UTSW 4 118726471 missense probably benign 0.00
R6481:Olfr1340 UTSW 4 118726733 missense probably damaging 1.00
R6930:Olfr1340 UTSW 4 118727141 missense probably damaging 1.00
R7662:Olfr1340 UTSW 4 118726307 missense probably damaging 0.99
R7681:Olfr1340 UTSW 4 118726564 missense probably benign 0.00
R7782:Olfr1340 UTSW 4 118726909 missense probably damaging 1.00
R7845:Olfr1340 UTSW 4 118726961 missense probably benign 0.00
R7928:Olfr1340 UTSW 4 118726961 missense probably benign 0.00
T0970:Olfr1340 UTSW 4 118726267 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTGAGTTATGCCACCACGAC -3'
(R):5'- AAGCCCAGGATGAAGTCTACTTG -3'

Sequencing Primer
(F):5'- ACCGTGCCCCAGATGTTG -3'
(R):5'- CCAGGATGAAGTCTACTTGGTCATTG -3'
Posted On2015-07-21