Incidental Mutation 'R4463:Kifc3'
ID330227
Institutional Source Beutler Lab
Gene Symbol Kifc3
Ensembl Gene ENSMUSG00000031788
Gene Namekinesin family member C3
Synonyms
MMRRC Submission 041721-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4463 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95099828-95202812 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95102116 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 638 (T638A)
Ref Sequence ENSEMBL: ENSMUSP00000127427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034239] [ENSMUST00000034240] [ENSMUST00000169353] [ENSMUST00000169748] [ENSMUST00000212968] [ENSMUST00000213004]
Predicted Effect probably benign
Transcript: ENSMUST00000034239
SMART Domains Protein: ENSMUSP00000034239
Gene: ENSMUSG00000031787

DomainStartEndE-ValueType
WD40 9 49 2.61e-3 SMART
WD40 52 91 2.45e-8 SMART
WD40 94 133 3.58e-10 SMART
WD40 136 175 7.49e-13 SMART
WD40 178 217 5.14e-11 SMART
WD40 220 258 1.14e-3 SMART
low complexity region 354 373 N/A INTRINSIC
low complexity region 396 412 N/A INTRINSIC
Pfam:Katanin_con80 496 654 8.2e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000034240
AA Change: T753A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788
AA Change: T753A

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
coiled coil region 100 360 N/A INTRINSIC
coiled coil region 393 430 N/A INTRINSIC
KISc 441 774 3.15e-158 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169353
AA Change: T638A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788
AA Change: T638A

DomainStartEndE-ValueType
coiled coil region 33 223 N/A INTRINSIC
coiled coil region 256 293 N/A INTRINSIC
KISc 304 637 3.15e-158 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169748
AA Change: T707A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788
AA Change: T707A

DomainStartEndE-ValueType
coiled coil region 34 324 N/A INTRINSIC
coiled coil region 357 394 N/A INTRINSIC
KISc 405 728 3.11e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212895
Predicted Effect probably benign
Transcript: ENSMUST00000212968
Predicted Effect probably damaging
Transcript: ENSMUST00000213004
AA Change: T616A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.8919 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-14 family of microtubule motors. Members of this family play a role in the formation, maintenance and remodeling of the bipolar mitotic spindle. The protein encoded by this gene has cytoplasmic functions in the interphase cells. It may also be involved in the final stages of cytokinesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and appear phenotypically indistinguishable from wild-type littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,150,719 M1197V probably benign Het
Abcb1a T C 5: 8,719,981 probably benign Het
Abcc8 T C 7: 46,106,581 probably null Het
Alox12e A G 11: 70,318,256 L388P probably damaging Het
Aspm T A 1: 139,455,010 S27T possibly damaging Het
Capn2 G A 1: 182,479,764 probably benign Het
Catspere1 G A 1: 177,937,713 noncoding transcript Het
Ccdc158 T C 5: 92,634,300 D820G probably null Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Chd9 T A 8: 90,978,999 D761E probably benign Het
Chst8 T C 7: 34,675,220 D398G probably damaging Het
Clns1a T C 7: 97,720,949 probably benign Het
Cyp3a57 A T 5: 145,381,274 Y355F probably damaging Het
Cyp4f37 A G 17: 32,627,736 probably null Het
Eipr1 G A 12: 28,859,339 A202T probably damaging Het
Fam83a T C 15: 57,995,259 S232P probably damaging Het
Fastkd2 C T 1: 63,735,809 probably benign Het
Fgfr4 G A 13: 55,156,467 V107I probably benign Het
Gatad1 G T 5: 3,647,404 S72R probably benign Het
Gli2 T C 1: 118,836,008 D1471G probably damaging Het
Gm1330 A T 2: 149,003,144 Y36* probably null Het
Gm2056 A G 12: 88,027,359 D119G probably benign Het
Gm29125 T C 1: 80,383,186 noncoding transcript Het
Idi1 G A 13: 8,887,472 probably benign Het
Itgbl1 C T 14: 123,840,668 T190I probably damaging Het
Kbtbd3 G A 9: 4,331,257 G544R probably damaging Het
Lama1 G A 17: 67,761,700 C798Y probably damaging Het
Larp6 C A 9: 60,736,996 H140N probably damaging Het
Mctp1 A T 13: 76,712,087 D108V probably damaging Het
Myzap G T 9: 71,555,651 D204E probably benign Het
Neb GCC GC 2: 52,279,722 probably null Het
Olfr1189 T C 2: 88,592,632 V276A possibly damaging Het
Olfr1340 T C 4: 118,726,658 V137A probably benign Het
Olfr352 T C 2: 36,870,193 I209T probably benign Het
Phka1 A G X: 102,545,384 V818A probably benign Het
Plek T C 11: 16,981,873 Y326C possibly damaging Het
Pp2d1 A G 17: 53,515,858 I60T probably benign Het
Prmt3 T C 7: 49,818,089 Y348H probably damaging Het
Psg27 G T 7: 18,557,085 Q398K possibly damaging Het
Raver1 T C 9: 21,091,827 T51A probably benign Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Sectm1a T A 11: 121,069,651 I113L probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Snph A T 2: 151,594,115 S229T probably damaging Het
Stpg4 A G 17: 87,389,673 F183L probably benign Het
Tango6 A T 8: 106,689,074 T176S probably benign Het
Vmn1r196 A G 13: 22,293,683 Q164R probably benign Het
Vstm4 T A 14: 32,917,876 L236Q probably damaging Het
Xylb A G 9: 119,386,367 D462G probably benign Het
Zc2hc1c A G 12: 85,290,297 R243G probably damaging Het
Other mutations in Kifc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Kifc3 APN 8 95138016 missense probably damaging 1.00
IGL01904:Kifc3 APN 8 95137957 missense possibly damaging 0.81
IGL02019:Kifc3 APN 8 95107540 splice site probably benign
IGL02090:Kifc3 APN 8 95102480 missense probably damaging 1.00
IGL02355:Kifc3 APN 8 95109879 missense probably damaging 1.00
IGL02362:Kifc3 APN 8 95109879 missense probably damaging 1.00
IGL02620:Kifc3 APN 8 95109954 missense probably damaging 0.98
IGL02720:Kifc3 APN 8 95108365 missense probably benign 0.00
IGL03030:Kifc3 APN 8 95102412 missense probably damaging 1.00
IGL03327:Kifc3 APN 8 95108432 missense probably damaging 1.00
IGL03390:Kifc3 APN 8 95108613 missense probably damaging 1.00
R0233:Kifc3 UTSW 8 95101472 splice site probably null
R0281:Kifc3 UTSW 8 95103460 missense probably damaging 1.00
R0302:Kifc3 UTSW 8 95103470 missense possibly damaging 0.50
R0619:Kifc3 UTSW 8 95102665 missense probably benign 0.13
R0731:Kifc3 UTSW 8 95105733 missense probably damaging 1.00
R1017:Kifc3 UTSW 8 95105785 missense probably damaging 0.99
R1147:Kifc3 UTSW 8 95137918 missense probably damaging 1.00
R1147:Kifc3 UTSW 8 95137918 missense probably damaging 1.00
R1257:Kifc3 UTSW 8 95105772 missense probably damaging 0.98
R1472:Kifc3 UTSW 8 95137913 critical splice donor site probably null
R1480:Kifc3 UTSW 8 95109887 missense probably damaging 1.00
R1553:Kifc3 UTSW 8 95106542 missense possibly damaging 0.67
R2071:Kifc3 UTSW 8 95108353 critical splice donor site probably null
R2115:Kifc3 UTSW 8 95108713 missense probably damaging 1.00
R3703:Kifc3 UTSW 8 95104028 splice site probably benign
R3704:Kifc3 UTSW 8 95104028 splice site probably benign
R3705:Kifc3 UTSW 8 95104028 splice site probably benign
R4223:Kifc3 UTSW 8 95109982 missense probably damaging 0.96
R4508:Kifc3 UTSW 8 95107420 splice site probably null
R4980:Kifc3 UTSW 8 95126549 missense probably benign
R5032:Kifc3 UTSW 8 95102726 missense probably damaging 1.00
R5068:Kifc3 UTSW 8 95110216 missense possibly damaging 0.54
R5421:Kifc3 UTSW 8 95109845 missense probably damaging 0.99
R5556:Kifc3 UTSW 8 95108459 nonsense probably null
R6845:Kifc3 UTSW 8 95108679 missense probably benign 0.28
R7136:Kifc3 UTSW 8 95103449 missense probably benign 0.10
R7196:Kifc3 UTSW 8 95106611 missense probably benign 0.02
R7404:Kifc3 UTSW 8 95103464 missense probably benign 0.02
R7441:Kifc3 UTSW 8 95137987 missense probably benign 0.00
R7784:Kifc3 UTSW 8 95110692 critical splice donor site probably null
R7861:Kifc3 UTSW 8 95107537 critical splice acceptor site probably null
R8440:Kifc3 UTSW 8 95109794 missense possibly damaging 0.89
R8754:Kifc3 UTSW 8 95102396 missense probably damaging 1.00
X0023:Kifc3 UTSW 8 95109298 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACCAGCCTGAGTCTCACTC -3'
(R):5'- TGGTGACAGCAAGACCCTTATG -3'

Sequencing Primer
(F):5'- GAGTCTCACTCATGGAAGCCTC -3'
(R):5'- CCTGAGGTTCAGCAAGAGC -3'
Posted On2015-07-21