Incidental Mutation 'R4463:Kbtbd3'
ID330229
Institutional Source Beutler Lab
Gene Symbol Kbtbd3
Ensembl Gene ENSMUSG00000025893
Gene Namekelch repeat and BTB (POZ) domain containing 3
SynonymsBklhd3, 2200003A07Rik
MMRRC Submission 041721-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R4463 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location4309833-4331732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4331257 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 544 (G544R)
Ref Sequence ENSEMBL: ENSMUSP00000148445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049648] [ENSMUST00000212221]
Predicted Effect probably damaging
Transcript: ENSMUST00000049648
AA Change: G544R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050183
Gene: ENSMUSG00000025893
AA Change: G544R

DomainStartEndE-ValueType
BTB 48 145 1.83e-23 SMART
BACK 150 252 1.19e-26 SMART
Blast:Kelch 292 338 7e-15 BLAST
Kelch 339 399 2.56e0 SMART
Kelch 400 450 8.67e-4 SMART
Kelch 548 597 3.3e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212221
AA Change: G544R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.2131 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,150,719 M1197V probably benign Het
Abcb1a T C 5: 8,719,981 probably benign Het
Abcc8 T C 7: 46,106,581 probably null Het
Alox12e A G 11: 70,318,256 L388P probably damaging Het
Aspm T A 1: 139,455,010 S27T possibly damaging Het
Capn2 G A 1: 182,479,764 probably benign Het
Catspere1 G A 1: 177,937,713 noncoding transcript Het
Ccdc158 T C 5: 92,634,300 D820G probably null Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Chd9 T A 8: 90,978,999 D761E probably benign Het
Chst8 T C 7: 34,675,220 D398G probably damaging Het
Clns1a T C 7: 97,720,949 probably benign Het
Cyp3a57 A T 5: 145,381,274 Y355F probably damaging Het
Cyp4f37 A G 17: 32,627,736 probably null Het
Eipr1 G A 12: 28,859,339 A202T probably damaging Het
Fam83a T C 15: 57,995,259 S232P probably damaging Het
Fastkd2 C T 1: 63,735,809 probably benign Het
Fgfr4 G A 13: 55,156,467 V107I probably benign Het
Gatad1 G T 5: 3,647,404 S72R probably benign Het
Gli2 T C 1: 118,836,008 D1471G probably damaging Het
Gm1330 A T 2: 149,003,144 Y36* probably null Het
Gm2056 A G 12: 88,027,359 D119G probably benign Het
Gm29125 T C 1: 80,383,186 noncoding transcript Het
Idi1 G A 13: 8,887,472 probably benign Het
Itgbl1 C T 14: 123,840,668 T190I probably damaging Het
Kifc3 T C 8: 95,102,116 T638A probably damaging Het
Lama1 G A 17: 67,761,700 C798Y probably damaging Het
Larp6 C A 9: 60,736,996 H140N probably damaging Het
Mctp1 A T 13: 76,712,087 D108V probably damaging Het
Myzap G T 9: 71,555,651 D204E probably benign Het
Neb GCC GC 2: 52,279,722 probably null Het
Olfr1189 T C 2: 88,592,632 V276A possibly damaging Het
Olfr1340 T C 4: 118,726,658 V137A probably benign Het
Olfr352 T C 2: 36,870,193 I209T probably benign Het
Phka1 A G X: 102,545,384 V818A probably benign Het
Plek T C 11: 16,981,873 Y326C possibly damaging Het
Pp2d1 A G 17: 53,515,858 I60T probably benign Het
Prmt3 T C 7: 49,818,089 Y348H probably damaging Het
Psg27 G T 7: 18,557,085 Q398K possibly damaging Het
Raver1 T C 9: 21,091,827 T51A probably benign Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Sectm1a T A 11: 121,069,651 I113L probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Snph A T 2: 151,594,115 S229T probably damaging Het
Stpg4 A G 17: 87,389,673 F183L probably benign Het
Tango6 A T 8: 106,689,074 T176S probably benign Het
Vmn1r196 A G 13: 22,293,683 Q164R probably benign Het
Vstm4 T A 14: 32,917,876 L236Q probably damaging Het
Xylb A G 9: 119,386,367 D462G probably benign Het
Zc2hc1c A G 12: 85,290,297 R243G probably damaging Het
Other mutations in Kbtbd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Kbtbd3 APN 9 4330169 missense probably benign
IGL00674:Kbtbd3 APN 9 4329949 missense probably benign 0.05
IGL00848:Kbtbd3 APN 9 4331184 missense probably damaging 1.00
IGL01949:Kbtbd3 APN 9 4331066 missense possibly damaging 0.95
IGL02619:Kbtbd3 APN 9 4331252 missense probably damaging 1.00
IGL02830:Kbtbd3 APN 9 4330096 missense possibly damaging 0.95
IGL02894:Kbtbd3 APN 9 4331444 missense probably benign 0.05
R0239:Kbtbd3 UTSW 9 4330144 missense possibly damaging 0.62
R0239:Kbtbd3 UTSW 9 4330144 missense possibly damaging 0.62
R0348:Kbtbd3 UTSW 9 4330519 missense possibly damaging 0.94
R0372:Kbtbd3 UTSW 9 4316950 missense possibly damaging 0.75
R0380:Kbtbd3 UTSW 9 4330545 nonsense probably null
R0644:Kbtbd3 UTSW 9 4329868 missense probably damaging 1.00
R1496:Kbtbd3 UTSW 9 4330276 missense probably benign
R1651:Kbtbd3 UTSW 9 4330589 missense possibly damaging 0.62
R1707:Kbtbd3 UTSW 9 4316985 missense probably benign 0.01
R1998:Kbtbd3 UTSW 9 4330760 missense probably benign 0.01
R2012:Kbtbd3 UTSW 9 4330919 missense probably benign
R2027:Kbtbd3 UTSW 9 4317075 splice site probably benign
R3717:Kbtbd3 UTSW 9 4330598 missense probably benign
R4482:Kbtbd3 UTSW 9 4331051 missense probably damaging 1.00
R4795:Kbtbd3 UTSW 9 4331073 nonsense probably null
R5195:Kbtbd3 UTSW 9 4316905 missense possibly damaging 0.74
R5645:Kbtbd3 UTSW 9 4331426 missense possibly damaging 0.92
R5753:Kbtbd3 UTSW 9 4331404 missense possibly damaging 0.74
R5898:Kbtbd3 UTSW 9 4330476 missense probably damaging 0.97
R6463:Kbtbd3 UTSW 9 4316921 missense probably benign
R6681:Kbtbd3 UTSW 9 4330687 missense probably benign 0.00
R7284:Kbtbd3 UTSW 9 4330690 nonsense probably null
R7390:Kbtbd3 UTSW 9 4330424 missense probably benign 0.27
R7735:Kbtbd3 UTSW 9 4330846 missense possibly damaging 0.89
R7793:Kbtbd3 UTSW 9 4331221 missense probably damaging 1.00
R8005:Kbtbd3 UTSW 9 4330655 missense not run
R8050:Kbtbd3 UTSW 9 4330408 missense not run
X0024:Kbtbd3 UTSW 9 4331437 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTAGTAGCAGAGTTTGGGC -3'
(R):5'- GTTGCAATTTTAGAGCTCTCATGC -3'

Sequencing Primer
(F):5'- GGCAGTTTTTTCACGCT -3'
(R):5'- TGATTTGAATACCATGGGTCCC -3'
Posted On2015-07-21