Incidental Mutation 'R4463:Slc2a4'
ID 330238
Institutional Source Beutler Lab
Gene Symbol Slc2a4
Ensembl Gene ENSMUSG00000018566
Gene Name solute carrier family 2 (facilitated glucose transporter), member 4
Synonyms Glut-4, Glut4
MMRRC Submission 041721-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.682) question?
Stock # R4463 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 69942539-69948188 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 69943322 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018698] [ENSMUST00000018710] [ENSMUST00000108601] [ENSMUST00000135437] [ENSMUST00000141837] [ENSMUST00000142500] [ENSMUST00000149194] [ENSMUST00000178363] [ENSMUST00000179298]
AlphaFold P14142
Predicted Effect probably benign
Transcript: ENSMUST00000018698
SMART Domains Protein: ENSMUSP00000018698
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
low complexity region 2 68 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
CSP 96 164 2.54e-21 SMART
low complexity region 173 212 N/A INTRINSIC
low complexity region 220 242 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
low complexity region 317 339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000018710
SMART Domains Protein: ENSMUSP00000018710
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
Pfam:MFS_1 24 436 3.9e-16 PFAM
Pfam:Sugar_tr 27 483 1.7e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108601
SMART Domains Protein: ENSMUSP00000104242
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
CSP 19 87 2.54e-21 SMART
low complexity region 96 135 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 197 217 N/A INTRINSIC
low complexity region 240 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130377
Predicted Effect probably benign
Transcript: ENSMUST00000135437
SMART Domains Protein: ENSMUSP00000137092
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 57 5.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141837
SMART Domains Protein: ENSMUSP00000136806
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
Pfam:MFS_1 24 438 4.7e-17 PFAM
Pfam:Sugar_tr 26 453 6e-140 PFAM
low complexity region 462 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148395
Predicted Effect probably benign
Transcript: ENSMUST00000149194
SMART Domains Protein: ENSMUSP00000136684
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 47 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 122 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152487
Predicted Effect probably benign
Transcript: ENSMUST00000178363
SMART Domains Protein: ENSMUSP00000136455
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
PDB:4PYP|A 14 50 3e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178809
Predicted Effect probably benign
Transcript: ENSMUST00000179298
SMART Domains Protein: ENSMUSP00000136726
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
Pfam:Sugar_tr 26 242 6.9e-65 PFAM
Pfam:MFS_1 27 239 2e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family 2 (facilitated glucose transporter) family and encodes a protein that functions as an insulin-regulated facilitative glucose transporter. In the absence of insulin, this integral membrane protein is sequestered within the cells of muscle and adipose tissue. Within minutes of insulin stimulation, the protein moves to the cell surface and begins to transport glucose across the cell membrane. Mutations in this gene have been associated with noninsulin-dependent diabetes mellitus (NIDDM). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes impaired glucose metabolism in skeletal muscle and adipose tissue. Mice homozygous for a knock-out allele show premature death associated with cardiac hypertrophy, growth retardation, insulin resistance, reduced adipose tissue deposits, and muscle fatigue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,150,719 M1197V probably benign Het
Abcb1a T C 5: 8,719,981 probably benign Het
Abcc8 T C 7: 46,106,581 probably null Het
Alox12e A G 11: 70,318,256 L388P probably damaging Het
Aspm T A 1: 139,455,010 S27T possibly damaging Het
Capn2 G A 1: 182,479,764 probably benign Het
Catspere1 G A 1: 177,937,713 noncoding transcript Het
Ccdc158 T C 5: 92,634,300 D820G probably null Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Chd9 T A 8: 90,978,999 D761E probably benign Het
Chst8 T C 7: 34,675,220 D398G probably damaging Het
Clns1a T C 7: 97,720,949 probably benign Het
Cyp3a57 A T 5: 145,381,274 Y355F probably damaging Het
Cyp4f37 A G 17: 32,627,736 probably null Het
Eipr1 G A 12: 28,859,339 A202T probably damaging Het
Fam83a T C 15: 57,995,259 S232P probably damaging Het
Fastkd2 C T 1: 63,735,809 probably benign Het
Fgfr4 G A 13: 55,156,467 V107I probably benign Het
Gatad1 G T 5: 3,647,404 S72R probably benign Het
Gli2 T C 1: 118,836,008 D1471G probably damaging Het
Gm1330 A T 2: 149,003,144 Y36* probably null Het
Gm2056 A G 12: 88,027,359 D119G probably benign Het
Gm29125 T C 1: 80,383,186 noncoding transcript Het
Idi1 G A 13: 8,887,472 probably benign Het
Itgbl1 C T 14: 123,840,668 T190I probably damaging Het
Kbtbd3 G A 9: 4,331,257 G544R probably damaging Het
Kifc3 T C 8: 95,102,116 T638A probably damaging Het
Lama1 G A 17: 67,761,700 C798Y probably damaging Het
Larp6 C A 9: 60,736,996 H140N probably damaging Het
Mctp1 A T 13: 76,712,087 D108V probably damaging Het
Myzap G T 9: 71,555,651 D204E probably benign Het
Neb GCC GC 2: 52,279,722 probably null Het
Olfr1189 T C 2: 88,592,632 V276A possibly damaging Het
Olfr1340 T C 4: 118,726,658 V137A probably benign Het
Olfr352 T C 2: 36,870,193 I209T probably benign Het
Phka1 A G X: 102,545,384 V818A probably benign Het
Plek T C 11: 16,981,873 Y326C possibly damaging Het
Pp2d1 A G 17: 53,515,858 I60T probably benign Het
Prmt3 T C 7: 49,818,089 Y348H probably damaging Het
Psg27 G T 7: 18,557,085 Q398K possibly damaging Het
Raver1 T C 9: 21,091,827 T51A probably benign Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Sectm1a T A 11: 121,069,651 I113L probably benign Het
Snph A T 2: 151,594,115 S229T probably damaging Het
Stpg4 A G 17: 87,389,673 F183L probably benign Het
Tango6 A T 8: 106,689,074 T176S probably benign Het
Vmn1r196 A G 13: 22,293,683 Q164R probably benign Het
Vstm4 T A 14: 32,917,876 L236Q probably damaging Het
Xylb A G 9: 119,386,367 D462G probably benign Het
Zc2hc1c A G 12: 85,290,297 R243G probably damaging Het
Other mutations in Slc2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Slc2a4 APN 11 69945956 splice site probably benign
IGL01448:Slc2a4 APN 11 69945076 missense possibly damaging 0.80
IGL01593:Slc2a4 APN 11 69944828 missense probably damaging 0.98
IGL02188:Slc2a4 APN 11 69946330 start codon destroyed probably null 0.00
IGL02738:Slc2a4 APN 11 69946114 missense probably damaging 1.00
R0282:Slc2a4 UTSW 11 69946355 missense probably damaging 1.00
R0317:Slc2a4 UTSW 11 69946356 missense probably damaging 1.00
R0709:Slc2a4 UTSW 11 69946159 missense possibly damaging 0.92
R1598:Slc2a4 UTSW 11 69945018 missense probably benign 0.00
R1800:Slc2a4 UTSW 11 69946307 missense probably benign 0.08
R1885:Slc2a4 UTSW 11 69945007 missense probably benign 0.03
R1893:Slc2a4 UTSW 11 69946572 missense probably damaging 1.00
R2439:Slc2a4 UTSW 11 69945625 missense possibly damaging 0.93
R2847:Slc2a4 UTSW 11 69946171 missense probably damaging 1.00
R2849:Slc2a4 UTSW 11 69946171 missense probably damaging 1.00
R2865:Slc2a4 UTSW 11 69946116 missense probably damaging 1.00
R3001:Slc2a4 UTSW 11 69945925 nonsense probably null
R3002:Slc2a4 UTSW 11 69945925 nonsense probably null
R4455:Slc2a4 UTSW 11 69943322 unclassified probably benign
R4456:Slc2a4 UTSW 11 69943322 unclassified probably benign
R4622:Slc2a4 UTSW 11 69944774 unclassified probably benign
R4822:Slc2a4 UTSW 11 69946587 missense probably damaging 1.00
R5695:Slc2a4 UTSW 11 69946391 missense probably damaging 1.00
R6348:Slc2a4 UTSW 11 69945022 missense probably benign 0.03
R7294:Slc2a4 UTSW 11 69945399 missense probably benign 0.00
R7315:Slc2a4 UTSW 11 69946433 missense probably damaging 0.99
R7492:Slc2a4 UTSW 11 69946376 missense probably benign 0.42
R8060:Slc2a4 UTSW 11 69945010 missense possibly damaging 0.68
R9103:Slc2a4 UTSW 11 69945392 missense probably benign 0.24
R9416:Slc2a4 UTSW 11 69945902 missense probably benign 0.04
R9565:Slc2a4 UTSW 11 69946347 missense probably damaging 1.00
R9582:Slc2a4 UTSW 11 69946624 missense probably damaging 0.98
X0067:Slc2a4 UTSW 11 69944256 missense probably benign 0.11
Z1186:Slc2a4 UTSW 11 69943991 frame shift probably null
Z1186:Slc2a4 UTSW 11 69943992 unclassified probably benign
Z1186:Slc2a4 UTSW 11 69943993 frame shift probably null
Z1187:Slc2a4 UTSW 11 69943992 unclassified probably benign
Z1187:Slc2a4 UTSW 11 69943993 frame shift probably null
Z1188:Slc2a4 UTSW 11 69943992 unclassified probably benign
Z1188:Slc2a4 UTSW 11 69943993 frame shift probably null
Z1189:Slc2a4 UTSW 11 69943992 unclassified probably benign
Z1189:Slc2a4 UTSW 11 69943993 frame shift probably null
Z1190:Slc2a4 UTSW 11 69943993 frame shift probably null
Z1191:Slc2a4 UTSW 11 69943992 unclassified probably benign
Z1191:Slc2a4 UTSW 11 69943993 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTCTAGAGCTGAGTCTGGG -3'
(R):5'- AAGTGCCTGAAACCAGAGGC -3'

Sequencing Primer
(F):5'- CGGAGAAAGCCCATCTAGGTG -3'
(R):5'- CCGGACGTTTGACCAGATCTC -3'
Posted On 2015-07-21