Incidental Mutation 'R4463:Fgfr4'
ID 330246
Institutional Source Beutler Lab
Gene Symbol Fgfr4
Ensembl Gene ENSMUSG00000005320
Gene Name fibroblast growth factor receptor 4
Synonyms Fgfr-4
MMRRC Submission 041721-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4463 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 55300631-55316572 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 55304280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 107 (V107I)
Ref Sequence ENSEMBL: ENSMUSP00000005452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005452]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005452
AA Change: V107I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000005452
Gene: ENSMUSG00000005320
AA Change: V107I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IGc2 45 105 1.39e-11 SMART
IGc2 160 228 3.1e-18 SMART
IGc2 259 337 1.59e-6 SMART
low complexity region 369 387 N/A INTRINSIC
low complexity region 416 446 N/A INTRINSIC
TyrKc 464 740 1.67e-148 SMART
low complexity region 764 795 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162967
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are viable, healthy and overtly normal, except for a 10% weight reduction at weaning. Mice doubly homozygous for disruptions of Fgfr3 and Fgfr4 show novel phenotypes not seen in either single mutant, including dwarfismand defective respiratory alveogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,769,981 (GRCm39) probably benign Het
Abcc8 T C 7: 45,756,005 (GRCm39) probably null Het
Alox12e A G 11: 70,209,082 (GRCm39) L388P probably damaging Het
Aspm T A 1: 139,382,748 (GRCm39) S27T possibly damaging Het
Capn2 G A 1: 182,307,329 (GRCm39) probably benign Het
Catspere1 G A 1: 177,765,279 (GRCm39) noncoding transcript Het
Ccdc158 T C 5: 92,782,159 (GRCm39) D820G probably null Het
Cdkn2d C G 9: 21,202,185 (GRCm39) V21L probably benign Het
Chd9 T A 8: 91,705,627 (GRCm39) D761E probably benign Het
Chst8 T C 7: 34,374,645 (GRCm39) D398G probably damaging Het
Clns1a T C 7: 97,370,156 (GRCm39) probably benign Het
Cyp3a57 A T 5: 145,318,084 (GRCm39) Y355F probably damaging Het
Cyp4f37 A G 17: 32,846,710 (GRCm39) probably null Het
Eif1ad11 A G 12: 87,994,129 (GRCm39) D119G probably benign Het
Eipr1 G A 12: 28,909,338 (GRCm39) A202T probably damaging Het
Fam83a T C 15: 57,858,655 (GRCm39) S232P probably damaging Het
Fastkd2 C T 1: 63,774,968 (GRCm39) probably benign Het
Fcgbpl1 A G 7: 27,850,144 (GRCm39) M1197V probably benign Het
Gatad1 G T 5: 3,697,404 (GRCm39) S72R probably benign Het
Gli2 T C 1: 118,763,738 (GRCm39) D1471G probably damaging Het
Gm1330 A T 2: 148,845,064 (GRCm39) Y36* probably null Het
Gm29125 T C 1: 80,360,903 (GRCm39) noncoding transcript Het
Idi1 G A 13: 8,937,508 (GRCm39) probably benign Het
Itgbl1 C T 14: 124,078,080 (GRCm39) T190I probably damaging Het
Kbtbd3 G A 9: 4,331,257 (GRCm39) G544R probably damaging Het
Kifc3 T C 8: 95,828,744 (GRCm39) T638A probably damaging Het
Lama1 G A 17: 68,068,695 (GRCm39) C798Y probably damaging Het
Larp6 C A 9: 60,644,279 (GRCm39) H140N probably damaging Het
Mctp1 A T 13: 76,860,206 (GRCm39) D108V probably damaging Het
Myzap G T 9: 71,462,933 (GRCm39) D204E probably benign Het
Neb GCC GC 2: 52,169,734 (GRCm39) probably null Het
Or13p8 T C 4: 118,583,855 (GRCm39) V137A probably benign Het
Or1j20 T C 2: 36,760,205 (GRCm39) I209T probably benign Het
Or4c102 T C 2: 88,422,976 (GRCm39) V276A possibly damaging Het
Phka1 A G X: 101,588,990 (GRCm39) V818A probably benign Het
Plek T C 11: 16,931,873 (GRCm39) Y326C possibly damaging Het
Pp2d1 A G 17: 53,822,886 (GRCm39) I60T probably benign Het
Prmt3 T C 7: 49,467,837 (GRCm39) Y348H probably damaging Het
Psg27 G T 7: 18,291,010 (GRCm39) Q398K possibly damaging Het
Raver1 T C 9: 21,003,123 (GRCm39) T51A probably benign Het
Ripk2 T C 4: 16,151,968 (GRCm39) N197S possibly damaging Het
Sectm1a T A 11: 120,960,477 (GRCm39) I113L probably benign Het
Slc2a4 G A 11: 69,834,148 (GRCm39) probably benign Het
Snph A T 2: 151,436,035 (GRCm39) S229T probably damaging Het
Stpg4 A G 17: 87,697,101 (GRCm39) F183L probably benign Het
Tango6 A T 8: 107,415,706 (GRCm39) T176S probably benign Het
Vmn1r196 A G 13: 22,477,853 (GRCm39) Q164R probably benign Het
Vstm4 T A 14: 32,639,833 (GRCm39) L236Q probably damaging Het
Xylb A G 9: 119,215,433 (GRCm39) D462G probably benign Het
Zc2hc1c A G 12: 85,337,071 (GRCm39) R243G probably damaging Het
Other mutations in Fgfr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Fgfr4 APN 13 55,306,983 (GRCm39) missense probably damaging 0.99
IGL02140:Fgfr4 APN 13 55,308,992 (GRCm39) missense probably benign
IGL02817:Fgfr4 APN 13 55,304,481 (GRCm39) critical splice donor site probably null
interference UTSW 13 55,313,777 (GRCm39) missense probably damaging 1.00
Modest UTSW 13 55,314,064 (GRCm39) missense probably damaging 1.00
offense UTSW 13 55,309,328 (GRCm39) missense possibly damaging 0.81
R0153:Fgfr4 UTSW 13 55,309,198 (GRCm39) splice site probably benign
R0727:Fgfr4 UTSW 13 55,304,041 (GRCm39) splice site probably null
R1646:Fgfr4 UTSW 13 55,313,777 (GRCm39) missense probably damaging 1.00
R1749:Fgfr4 UTSW 13 55,315,605 (GRCm39) splice site probably null
R1993:Fgfr4 UTSW 13 55,313,715 (GRCm39) missense probably damaging 1.00
R2037:Fgfr4 UTSW 13 55,315,702 (GRCm39) missense possibly damaging 0.51
R2152:Fgfr4 UTSW 13 55,314,777 (GRCm39) missense probably damaging 1.00
R2386:Fgfr4 UTSW 13 55,315,714 (GRCm39) missense probably benign 0.36
R3086:Fgfr4 UTSW 13 55,315,205 (GRCm39) splice site probably benign
R3939:Fgfr4 UTSW 13 55,304,307 (GRCm39) missense probably null 0.96
R4255:Fgfr4 UTSW 13 55,314,064 (GRCm39) missense probably damaging 1.00
R4510:Fgfr4 UTSW 13 55,309,328 (GRCm39) missense possibly damaging 0.81
R4511:Fgfr4 UTSW 13 55,309,328 (GRCm39) missense possibly damaging 0.81
R4852:Fgfr4 UTSW 13 55,308,969 (GRCm39) missense possibly damaging 0.68
R4932:Fgfr4 UTSW 13 55,315,983 (GRCm39) missense unknown
R5133:Fgfr4 UTSW 13 55,307,828 (GRCm39) missense probably damaging 1.00
R5146:Fgfr4 UTSW 13 55,313,725 (GRCm39) missense probably damaging 1.00
R5380:Fgfr4 UTSW 13 55,315,230 (GRCm39) missense probably damaging 1.00
R5431:Fgfr4 UTSW 13 55,304,464 (GRCm39) missense probably benign
R5927:Fgfr4 UTSW 13 55,314,700 (GRCm39) missense probably damaging 1.00
R6318:Fgfr4 UTSW 13 55,313,921 (GRCm39) missense probably damaging 1.00
R6792:Fgfr4 UTSW 13 55,304,711 (GRCm39) missense possibly damaging 0.65
R7018:Fgfr4 UTSW 13 55,314,013 (GRCm39) missense probably damaging 0.98
R7290:Fgfr4 UTSW 13 55,309,262 (GRCm39) missense probably benign 0.00
R7343:Fgfr4 UTSW 13 55,306,968 (GRCm39) missense probably damaging 1.00
R7808:Fgfr4 UTSW 13 55,308,969 (GRCm39) missense possibly damaging 0.68
R7891:Fgfr4 UTSW 13 55,306,964 (GRCm39) missense probably benign 0.22
R9028:Fgfr4 UTSW 13 55,306,967 (GRCm39) missense probably damaging 1.00
R9144:Fgfr4 UTSW 13 55,315,837 (GRCm39) critical splice acceptor site probably null
R9257:Fgfr4 UTSW 13 55,315,974 (GRCm39) missense unknown
R9399:Fgfr4 UTSW 13 55,304,293 (GRCm39) missense probably damaging 1.00
R9457:Fgfr4 UTSW 13 55,308,940 (GRCm39) missense probably benign
R9553:Fgfr4 UTSW 13 55,309,228 (GRCm39) missense probably damaging 0.99
R9620:Fgfr4 UTSW 13 55,308,994 (GRCm39) missense possibly damaging 0.68
Z1177:Fgfr4 UTSW 13 55,313,742 (GRCm39) missense probably damaging 1.00
Z1177:Fgfr4 UTSW 13 55,309,520 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAAGAGCAGGTGTTGAC -3'
(R):5'- TGGGTAGACATGACCACTCG -3'

Sequencing Primer
(F):5'- CAGGTGTTGACGGTGGCC -3'
(R):5'- ACATGACCACTCGAGGAGCTG -3'
Posted On 2015-07-21